Incidental Mutation 'R4011:Kat2b'
ID311714
Institutional Source Beutler Lab
Gene Symbol Kat2b
Ensembl Gene ENSMUSG00000000708
Gene NameK(lysine) acetyltransferase 2B
SynonymsPcaf, A930006P13Rik
MMRRC Submission 040948-MU
Accession Numbers

Genbank: NM_020005

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4011 (G1)
Quality Score184
Status Validated
Chromosome17
Chromosomal Location53566861-53672720 bp(+) (GRCm38)
Type of Mutationsplice site (5 bp from exon)
DNA Base Change (assembly) G to A at 53644741 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000126232 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000000724] [ENSMUST00000166525]
Predicted Effect probably null
Transcript: ENSMUST00000000724
SMART Domains Protein: ENSMUSP00000000724
Gene: ENSMUSG00000000708

DomainStartEndE-ValueType
low complexity region 4 21 N/A INTRINSIC
low complexity region 32 55 N/A INTRINSIC
Pfam:PCAF_N 56 308 6.2e-114 PFAM
low complexity region 461 472 N/A INTRINSIC
Pfam:Acetyltransf_7 522 605 1.5e-11 PFAM
Pfam:Acetyltransf_1 530 604 3.2e-11 PFAM
low complexity region 643 659 N/A INTRINSIC
BROMO 702 810 1.08e-44 SMART
Predicted Effect probably null
Transcript: ENSMUST00000166525
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 93.7%
Validation Efficiency 100% (43/43)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] CBP and p300 are large nuclear proteins that bind to many sequence-specific factors involved in cell growth and/or differentiation, including c-jun and the adenoviral oncoprotein E1A. The protein encoded by this gene associates with p300/CBP. It has in vitro and in vivo binding activity with CBP and p300, and competes with E1A for binding sites in p300/CBP. It has histone acetyl transferase activity with core histones and nucleosome core particles, indicating that this protein plays a direct role in transcriptional regulation. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null allele exhibit no abrnomal phenotype. [provided by MGI curators]
Allele List at MGI

All alleles(122) : Targeted, knock-out(2) Targeted, other(1) Gene trapped(119)

Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 G A 11: 9,622,013 probably benign Het
Acss2 T A 2: 155,557,628 L529Q probably damaging Het
Adsl T C 15: 80,966,156 S359P probably benign Het
C1qtnf1 G A 11: 118,446,539 G65D probably benign Het
Chd1l A T 3: 97,570,402 M679K probably benign Het
Cspg4 A G 9: 56,887,317 T779A probably benign Het
Ddx18 T C 1: 121,562,081 I200V probably benign Het
Dnah9 T A 11: 65,834,464 M4288L probably damaging Het
F830045P16Rik A T 2: 129,463,547 N302K probably damaging Het
Gas1 T G 13: 60,175,977 D322A unknown Het
Gfm2 T A 13: 97,143,100 probably benign Het
Gm11487 T C 4: 73,401,810 Y244C probably damaging Het
Gm5592 G T 7: 41,289,510 V739L probably benign Het
Hbb-bh2 T A 7: 103,840,209 H45L probably benign Het
Ifit2 G T 19: 34,574,045 M328I probably benign Het
Igdcc4 T C 9: 65,135,479 V1237A probably benign Het
Lmtk2 A G 5: 144,175,879 N1139S probably benign Het
Map1a G A 2: 121,300,127 A475T probably damaging Het
Map3k20 G A 2: 72,384,124 probably benign Het
Mga T C 2: 119,931,780 V1084A probably damaging Het
Myo3b A G 2: 70,096,376 I5V probably benign Het
Olfr110 T C 17: 37,499,491 V280A possibly damaging Het
Olfr1118 A G 2: 87,309,211 I141V probably benign Het
Olfr1122 A T 2: 87,388,580 I292F possibly damaging Het
Olfr192 G A 16: 59,098,761 T77I unknown Het
Olfr512 A T 7: 108,714,159 I269L probably benign Het
Olfr657 A G 7: 104,636,348 T225A probably benign Het
Osmr G T 15: 6,824,533 R565S probably benign Het
Pcolce G T 5: 137,605,774 Q344K probably benign Het
Prdm11 A G 2: 93,012,830 F95L probably damaging Het
Psd2 C T 18: 35,987,247 T383I probably benign Het
Reg3a G A 6: 78,383,570 D164N probably damaging Het
Serpina3a A T 12: 104,118,643 D99V probably benign Het
Sgce G T 6: 4,691,563 Y301* probably null Het
Slc28a3 T C 13: 58,566,250 K434E probably benign Het
Slc30a3 A G 5: 31,086,859 F360L probably damaging Het
Tdpoz3 A T 3: 93,826,243 Y75F possibly damaging Het
Trim65 A G 11: 116,127,703 F249L probably benign Het
Tubgcp3 A T 8: 12,639,634 L544* probably null Het
Vit C T 17: 78,534,692 probably benign Het
Wdfy4 C A 14: 33,102,680 probably benign Het
Xpo6 T C 7: 126,140,608 K431E probably benign Het
Xrn1 T A 9: 95,985,225 Y545* probably null Het
Other mutations in Kat2b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00473:Kat2b APN 17 53663623 missense possibly damaging 0.46
IGL00793:Kat2b APN 17 53665824 missense probably benign 0.00
IGL01628:Kat2b APN 17 53610897 missense possibly damaging 0.89
IGL02494:Kat2b APN 17 53653205 missense probably damaging 1.00
IGL03347:Kat2b APN 17 53624351 critical splice acceptor site probably null
cakewalk UTSW 17 53638522 missense probably damaging 1.00
D605:Kat2b UTSW 17 53629330 missense probably damaging 1.00
R0060:Kat2b UTSW 17 53654543 missense probably damaging 1.00
R0225:Kat2b UTSW 17 53641210 missense probably damaging 1.00
R0372:Kat2b UTSW 17 53638537 missense possibly damaging 0.95
R0638:Kat2b UTSW 17 53644743 splice site probably benign
R0639:Kat2b UTSW 17 53567538 missense probably benign 0.38
R0780:Kat2b UTSW 17 53567448 missense unknown
R1240:Kat2b UTSW 17 53624397 missense probably benign 0.00
R2346:Kat2b UTSW 17 53610904 missense probably benign 0.07
R3402:Kat2b UTSW 17 53665853 missense probably damaging 1.00
R3776:Kat2b UTSW 17 53567581 splice site probably null
R4009:Kat2b UTSW 17 53644741 splice site probably null
R4543:Kat2b UTSW 17 53653140 missense probably benign
R4598:Kat2b UTSW 17 53670798 missense probably benign 0.02
R4785:Kat2b UTSW 17 53653203 missense possibly damaging 0.81
R5079:Kat2b UTSW 17 53663638 missense probably damaging 1.00
R5475:Kat2b UTSW 17 53663581 missense probably damaging 1.00
R6993:Kat2b UTSW 17 53638522 missense probably damaging 1.00
R7047:Kat2b UTSW 17 53663569 missense probably benign 0.01
R7058:Kat2b UTSW 17 53665866 missense probably benign 0.00
R7199:Kat2b UTSW 17 53670678 missense probably damaging 1.00
R7276:Kat2b UTSW 17 53624422 missense probably damaging 1.00
R7418:Kat2b UTSW 17 53610925 missense possibly damaging 0.94
R7535:Kat2b UTSW 17 53624403 missense probably damaging 1.00
R7561:Kat2b UTSW 17 53641258 missense probably benign 0.22
R7723:Kat2b UTSW 17 53638387 missense possibly damaging 0.62
Predicted Primers PCR Primer
(F):5'- AGGCAGTCATAGGATGGCTTTATG -3'
(R):5'- TGGCTTGTTTGTTACACAGCAG -3'

Sequencing Primer
(F):5'- ATGGTCTCACATGTCCTTGAG -3'
(R):5'- GCTTGTTTGTTACACAGCAGTACAC -3'
Posted On2015-04-29