Incidental Mutation 'R4011:Ifit2'
ID311717
Institutional Source Beutler Lab
Gene Symbol Ifit2
Ensembl Gene ENSMUSG00000045932
Gene Nameinterferon-induced protein with tetratricopeptide repeats 2
SynonymsIfi54
MMRRC Submission 040948-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.073) question?
Stock #R4011 (G1)
Quality Score225
Status Validated
Chromosome19
Chromosomal Location34550694-34576419 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 34574045 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Isoleucine at position 328 (M328I)
Ref Sequence ENSEMBL: ENSMUSP00000099890 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000102826] [ENSMUST00000149829]
Predicted Effect probably benign
Transcript: ENSMUST00000102826
AA Change: M328I

PolyPhen 2 Score 0.381 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000099890
Gene: ENSMUSG00000045932
AA Change: M328I

DomainStartEndE-ValueType
Pfam:TPR_2 95 127 4e-4 PFAM
Pfam:TPR_8 95 127 3.8e-4 PFAM
Blast:TPR 138 171 7e-11 BLAST
Blast:TPR 172 208 2e-9 BLAST
low complexity region 211 222 N/A INTRINSIC
Pfam:TPR_19 225 286 4e-8 PFAM
low complexity region 396 406 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000149829
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 93.7%
Validation Efficiency 100% (43/43)
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit increased susuceptibility to VSV infection with increased lethality and brain viral titer. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 G A 11: 9,622,013 probably benign Het
Acss2 T A 2: 155,557,628 L529Q probably damaging Het
Adsl T C 15: 80,966,156 S359P probably benign Het
C1qtnf1 G A 11: 118,446,539 G65D probably benign Het
Chd1l A T 3: 97,570,402 M679K probably benign Het
Cspg4 A G 9: 56,887,317 T779A probably benign Het
Ddx18 T C 1: 121,562,081 I200V probably benign Het
Dnah9 T A 11: 65,834,464 M4288L probably damaging Het
F830045P16Rik A T 2: 129,463,547 N302K probably damaging Het
Gas1 T G 13: 60,175,977 D322A unknown Het
Gfm2 T A 13: 97,143,100 probably benign Het
Gm11487 T C 4: 73,401,810 Y244C probably damaging Het
Gm5592 G T 7: 41,289,510 V739L probably benign Het
Hbb-bh2 T A 7: 103,840,209 H45L probably benign Het
Igdcc4 T C 9: 65,135,479 V1237A probably benign Het
Kat2b G A 17: 53,644,741 probably null Het
Lmtk2 A G 5: 144,175,879 N1139S probably benign Het
Map1a G A 2: 121,300,127 A475T probably damaging Het
Map3k20 G A 2: 72,384,124 probably benign Het
Mga T C 2: 119,931,780 V1084A probably damaging Het
Myo3b A G 2: 70,096,376 I5V probably benign Het
Olfr110 T C 17: 37,499,491 V280A possibly damaging Het
Olfr1118 A G 2: 87,309,211 I141V probably benign Het
Olfr1122 A T 2: 87,388,580 I292F possibly damaging Het
Olfr192 G A 16: 59,098,761 T77I unknown Het
Olfr512 A T 7: 108,714,159 I269L probably benign Het
Olfr657 A G 7: 104,636,348 T225A probably benign Het
Osmr G T 15: 6,824,533 R565S probably benign Het
Pcolce G T 5: 137,605,774 Q344K probably benign Het
Prdm11 A G 2: 93,012,830 F95L probably damaging Het
Psd2 C T 18: 35,987,247 T383I probably benign Het
Reg3a G A 6: 78,383,570 D164N probably damaging Het
Serpina3a A T 12: 104,118,643 D99V probably benign Het
Sgce G T 6: 4,691,563 Y301* probably null Het
Slc28a3 T C 13: 58,566,250 K434E probably benign Het
Slc30a3 A G 5: 31,086,859 F360L probably damaging Het
Tdpoz3 A T 3: 93,826,243 Y75F possibly damaging Het
Trim65 A G 11: 116,127,703 F249L probably benign Het
Tubgcp3 A T 8: 12,639,634 L544* probably null Het
Vit C T 17: 78,534,692 probably benign Het
Wdfy4 C A 14: 33,102,680 probably benign Het
Xpo6 T C 7: 126,140,608 K431E probably benign Het
Xrn1 T A 9: 95,985,225 Y545* probably null Het
Other mutations in Ifit2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01099:Ifit2 APN 19 34573302 missense probably damaging 1.00
IGL02261:Ifit2 APN 19 34574224 missense probably damaging 1.00
IGL02375:Ifit2 APN 19 34574337 missense probably benign 0.01
Pushup UTSW 19 34574045 missense probably benign 0.38
R0017:Ifit2 UTSW 19 34573573 missense probably damaging 1.00
R0017:Ifit2 UTSW 19 34573573 missense probably damaging 1.00
R0682:Ifit2 UTSW 19 34573612 missense probably benign 0.13
R0927:Ifit2 UTSW 19 34573584 missense probably benign 0.03
R1462:Ifit2 UTSW 19 34573186 missense probably null 0.12
R1462:Ifit2 UTSW 19 34573186 missense probably null 0.12
R1526:Ifit2 UTSW 19 34573202 missense probably benign 0.00
R2084:Ifit2 UTSW 19 34573350 missense probably damaging 1.00
R3971:Ifit2 UTSW 19 34574041 missense probably benign 0.00
R4008:Ifit2 UTSW 19 34574045 missense probably benign 0.38
R4010:Ifit2 UTSW 19 34574045 missense probably benign 0.38
R4359:Ifit2 UTSW 19 34573144 missense possibly damaging 0.85
R5179:Ifit2 UTSW 19 34573576 missense probably damaging 1.00
R5240:Ifit2 UTSW 19 34574396 missense probably benign 0.02
R5424:Ifit2 UTSW 19 34574058 missense probably benign 0.19
R5528:Ifit2 UTSW 19 34573537 missense possibly damaging 0.63
R6605:Ifit2 UTSW 19 34573497 nonsense probably null
R7172:Ifit2 UTSW 19 34573494 missense probably benign 0.24
R7424:Ifit2 UTSW 19 34573198 missense probably benign 0.37
R8090:Ifit2 UTSW 19 34573262 missense possibly damaging 0.70
X0023:Ifit2 UTSW 19 34574250 missense possibly damaging 0.59
X0064:Ifit2 UTSW 19 34573923 missense probably benign 0.06
Predicted Primers PCR Primer
(F):5'- GCAGCCAGGTTTTATTGCAAG -3'
(R):5'- AGATAGCCTTGTCTTGACGCTTC -3'

Sequencing Primer
(F):5'- CAGACAGAGCTATACAGTTGCTTAG -3'
(R):5'- ATAGCCTTGTCTTGACGCTTCATTTG -3'
Posted On2015-04-29