Incidental Mutation 'R4012:Erbb4'
ID311722
Institutional Source Beutler Lab
Gene Symbol Erbb4
Ensembl Gene ENSMUSG00000062209
Gene Nameerb-b2 receptor tyrosine kinase 4
SynonymsHer4, ErbB4
MMRRC Submission 040949-MU
Accession Numbers

Ncbi RefSeq: NM_010154.1; MGI:104771

Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4012 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location68032186-69108059 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 68560576 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Histidine at position 114 (R114H)
Ref Sequence ENSEMBL: ENSMUSP00000114123 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000119142] [ENSMUST00000121473] [ENSMUST00000153432]
Predicted Effect probably damaging
Transcript: ENSMUST00000119142
AA Change: R114H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000112713
Gene: ENSMUSG00000062209
AA Change: R114H

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
Pfam:Recep_L_domain 55 167 5e-34 PFAM
FU 183 223 2.07e1 SMART
FU 226 268 5.78e-10 SMART
Pfam:Recep_L_domain 358 478 1e-29 PFAM
FU 493 544 6.45e-8 SMART
FU 549 599 3.51e-9 SMART
FU 611 659 2.32e0 SMART
TyrKc 718 974 7.53e-133 SMART
low complexity region 1007 1023 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000121473
AA Change: R114H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000114123
Gene: ENSMUSG00000062209
AA Change: R114H

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
Pfam:Recep_L_domain 55 167 1.6e-34 PFAM
FU 183 223 2.07e1 SMART
FU 226 268 5.78e-10 SMART
Pfam:Recep_L_domain 358 478 5.5e-29 PFAM
FU 493 544 6.45e-8 SMART
FU 549 599 3.51e-9 SMART
FU 611 659 2.32e0 SMART
TyrKc 718 974 7.53e-133 SMART
low complexity region 1007 1023 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000153432
AA Change: R114H

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000115373
Gene: ENSMUSG00000062209
AA Change: R114H

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
Pfam:Recep_L_domain 55 167 1.7e-34 PFAM
FU 183 223 2.07e1 SMART
FU 226 268 5.78e-10 SMART
Pfam:Recep_L_domain 358 478 5.7e-29 PFAM
FU 493 544 6.45e-8 SMART
FU 549 599 3.51e-9 SMART
FU 611 649 2.98e0 SMART
PDB:2R4B|B 680 732 1e-25 PDB
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 93.0%
Validation Efficiency 100% (79/79)
MGI Phenotype Strain: 1929607
Lethality: E10-E11
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the Tyr protein kinase family and the epidermal growth factor receptor subfamily. It encodes a single-pass type I membrane protein with multiple cysteine rich domains, a transmembrane domain, a tyrosine kinase domain, a phosphotidylinositol-3 kinase binding site and a PDZ domain binding motif. The protein binds to and is activated by neuregulins and other factors and induces a variety of cellular responses including mitogenesis and differentiation. Multiple proteolytic events allow for the release of a cytoplasmic fragment and an extracellular fragment. Mutations in this gene have been associated with cancer. Alternatively spliced variants which encode different protein isoforms have been described; however, not all variants have been fully characterized. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit cardiac defects, alterations in hindbrain development, and midgestational lethality. Heterozygotes show schizophrenia-like behavior. Genetically rescued females show mammary defects. [provided by MGI curators]
Allele List at MGI

All alleles(7) : Targeted(6) Gene trapped(1)

Other mutations in this stock
Total: 79 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700015F17Rik A C 5: 5,478,955 L20R probably damaging Het
2210016F16Rik T A 13: 58,381,986 K271* probably null Het
9930021J03Rik T G 19: 29,743,590 K622N probably damaging Het
Adnp2 G T 18: 80,130,821 F124L probably benign Het
Aicda A G 6: 122,559,490 K10E probably benign Het
Als2 A G 1: 59,187,416 C910R probably benign Het
Ankrd11 T A 8: 122,892,417 K1565N probably damaging Het
Apol7b T C 15: 77,424,709 D63G probably damaging Het
Arhgef4 T C 1: 34,725,106 C1148R possibly damaging Het
Atg16l1 A G 1: 87,766,907 D102G probably damaging Het
Babam2 T C 5: 32,001,438 V244A probably damaging Het
Cars G A 7: 143,559,674 A668V possibly damaging Het
Ccdc185 T A 1: 182,748,888 S79C possibly damaging Het
Ccdc88b G C 19: 6,848,991 R1119G probably damaging Het
Cebpz A T 17: 78,924,467 V810E probably damaging Het
Cep120 T C 18: 53,738,582 T73A probably damaging Het
Chat C A 14: 32,423,312 C380F possibly damaging Het
Cltc T C 11: 86,757,261 Q10R probably benign Het
Cst8 T C 2: 148,804,702 probably benign Het
Cts3 C T 13: 61,568,054 probably null Het
Cyp4a29 T A 4: 115,248,510 D136E probably benign Het
Dmxl2 A C 9: 54,379,013 probably null Het
Dsg4 T A 18: 20,451,862 V211E possibly damaging Het
Efcab5 C T 11: 77,117,830 V957I probably damaging Het
Eif4g2 A T 7: 111,074,151 L807Q possibly damaging Het
Epha4 A G 1: 77,390,094 probably benign Het
Epm2aip1 A T 9: 111,272,390 I144F probably benign Het
Fabp3 C T 4: 130,312,387 T57I probably benign Het
Fam170a C T 18: 50,281,971 A228V probably damaging Het
Foxred1 A T 9: 35,206,275 M254K possibly damaging Het
Gm1527 T A 3: 28,898,820 C90S probably benign Het
Gm16286 A G 18: 80,212,124 D211G probably benign Het
Gm8251 T C 1: 44,060,969 D323G possibly damaging Het
Gpr137b T C 13: 13,359,362 T370A probably benign Het
Gtf2e2 A G 8: 33,755,965 probably benign Het
Hgsnat A T 8: 25,955,789 L359* probably null Het
Hhip A T 8: 79,992,594 C435S probably damaging Het
Hoxa13 T C 6: 52,259,127 D310G possibly damaging Het
Hspa14 T C 2: 3,512,638 Y18C probably damaging Het
Ighg1 A G 12: 113,329,650 V140A probably damaging Het
Ighv1-58 A T 12: 115,312,310 Y69* probably null Het
Inpp5j A G 11: 3,500,185 F615L probably benign Het
Kcna1 T A 6: 126,642,910 Y149F probably benign Het
Kcnj6 A T 16: 94,825,018 probably null Het
Krtap4-1 G T 11: 99,627,811 C124* probably null Het
Lama1 T A 17: 67,812,373 L2615* probably null Het
Lcp2 A T 11: 34,068,439 I72F probably damaging Het
Med1 T A 11: 98,171,706 I189F possibly damaging Het
Meioc C T 11: 102,675,828 R757C probably damaging Het
Mtr T A 13: 12,189,397 H1171L probably damaging Het
Mtr G C 13: 12,189,398 H1171D probably damaging Het
Nlrc5 A G 8: 94,475,992 Y240C possibly damaging Het
Nsun4 T A 4: 116,051,062 H767L possibly damaging Het
Pcdha1 T A 18: 36,931,136 N284K probably benign Het
Pcdhgb8 A C 18: 37,763,361 S495R probably benign Het
Pramel1 T A 4: 143,396,690 I79N possibly damaging Het
Prdm6 A T 18: 53,540,318 E183D possibly damaging Het
Prex2 T C 1: 11,184,516 F1125L probably benign Het
Prkg2 T C 5: 98,979,815 I346V possibly damaging Het
Ptprz1 A G 6: 23,002,585 D1558G probably damaging Het
Rab11fip3 GCTCGTCT GCT 17: 26,068,028 probably null Het
Rin2 C T 2: 145,860,446 T354I probably benign Het
S100a6 A G 3: 90,614,201 D50G probably damaging Het
Shroom3 T A 5: 92,948,483 probably benign Het
Sipa1l1 G A 12: 82,341,782 V261M possibly damaging Het
Slc5a4b T A 10: 76,074,992 I337F probably damaging Het
Smarcc1 A G 9: 110,132,205 Y30C possibly damaging Het
Swap70 A G 7: 110,281,305 K576E possibly damaging Het
Syt6 A G 3: 103,625,493 probably benign Het
Szt2 T C 4: 118,383,900 I1726V probably benign Het
Tdgf1 C T 9: 110,940,713 M169I probably benign Het
Thoc1 A G 18: 9,987,651 K453E possibly damaging Het
Tmem38b A G 4: 53,854,409 I214V probably benign Het
Tonsl A T 15: 76,637,044 I354N probably damaging Het
Trappc9 T C 15: 73,031,623 I303V possibly damaging Het
Trim66 A G 7: 109,458,131 S1032P probably damaging Het
Tsc22d4 T C 5: 137,758,328 V6A probably benign Het
Ubtd2 A G 11: 32,499,260 K36E probably benign Het
Zkscan2 T C 7: 123,498,660 E171G possibly damaging Het
Other mutations in Erbb4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00965:Erbb4 APN 1 68071630 nonsense probably null
IGL01020:Erbb4 APN 1 68298449 splice site probably benign
IGL01349:Erbb4 APN 1 68346593 missense probably benign 0.00
IGL01386:Erbb4 APN 1 68343931 missense probably damaging 1.00
IGL01516:Erbb4 APN 1 68328245 nonsense probably null
IGL01536:Erbb4 APN 1 68290282 missense probably benign 0.00
IGL01721:Erbb4 APN 1 68254563 missense possibly damaging 0.46
IGL01832:Erbb4 APN 1 68254566 missense possibly damaging 0.84
IGL02002:Erbb4 APN 1 68080726 missense probably damaging 1.00
IGL02040:Erbb4 APN 1 68042535 missense probably damaging 1.00
IGL02371:Erbb4 APN 1 68290294 missense probably benign 0.00
IGL02399:Erbb4 APN 1 68042437 splice site probably benign
IGL02553:Erbb4 APN 1 68305864 missense probably benign 0.17
IGL03118:Erbb4 APN 1 68042719 missense probably benign 0.11
IGL03329:Erbb4 APN 1 68328122 missense probably benign 0.30
IGL03405:Erbb4 APN 1 68330238 missense probably benign 0.02
excrescence UTSW 1 68330246 missense probably damaging 1.00
Mole UTSW 1 68560576 missense probably damaging 1.00
P0018:Erbb4 UTSW 1 68071676 missense probably benign 0.05
PIT4480001:Erbb4 UTSW 1 68075543 missense probably damaging 1.00
R0193:Erbb4 UTSW 1 68043960 intron probably benign
R0329:Erbb4 UTSW 1 68298280 splice site probably benign
R0335:Erbb4 UTSW 1 68259259 missense probably benign
R0362:Erbb4 UTSW 1 68330270 missense probably damaging 0.99
R0579:Erbb4 UTSW 1 68042462 missense probably benign 0.17
R0730:Erbb4 UTSW 1 68259290 missense probably damaging 0.98
R1029:Erbb4 UTSW 1 68309614 missense probably damaging 0.96
R1444:Erbb4 UTSW 1 68254600 missense probably damaging 1.00
R1469:Erbb4 UTSW 1 68560682 missense probably damaging 0.99
R1469:Erbb4 UTSW 1 68560682 missense probably damaging 0.99
R1503:Erbb4 UTSW 1 68346546 missense probably benign 0.00
R1523:Erbb4 UTSW 1 68396252 missense possibly damaging 0.95
R1528:Erbb4 UTSW 1 68078582 nonsense probably null
R1604:Erbb4 UTSW 1 68346569 missense possibly damaging 0.88
R1611:Erbb4 UTSW 1 68040388 missense probably damaging 1.00
R1642:Erbb4 UTSW 1 68331234 missense probably damaging 1.00
R1905:Erbb4 UTSW 1 68075410 splice site probably benign
R1929:Erbb4 UTSW 1 68198888 missense probably damaging 0.98
R2046:Erbb4 UTSW 1 68298323 missense probably benign 0.02
R2139:Erbb4 UTSW 1 68346629 missense probably damaging 0.96
R2271:Erbb4 UTSW 1 68198888 missense probably damaging 0.98
R2298:Erbb4 UTSW 1 68042531 missense probably damaging 1.00
R2356:Erbb4 UTSW 1 68078596 missense probably benign 0.00
R3821:Erbb4 UTSW 1 68305913 missense probably damaging 0.97
R4007:Erbb4 UTSW 1 68740401 missense probably damaging 1.00
R4077:Erbb4 UTSW 1 68040337 missense probably benign 0.07
R4196:Erbb4 UTSW 1 68343855 missense possibly damaging 0.90
R4536:Erbb4 UTSW 1 68346622 missense probably damaging 1.00
R4561:Erbb4 UTSW 1 68343921 nonsense probably null
R4642:Erbb4 UTSW 1 68250632 missense probably damaging 1.00
R4737:Erbb4 UTSW 1 68343900 missense probably damaging 0.98
R4739:Erbb4 UTSW 1 68343900 missense probably damaging 0.98
R4780:Erbb4 UTSW 1 68298314 missense probably damaging 1.00
R4801:Erbb4 UTSW 1 68330246 missense probably damaging 1.00
R4802:Erbb4 UTSW 1 68330246 missense probably damaging 1.00
R4811:Erbb4 UTSW 1 68254544 missense probably damaging 1.00
R4832:Erbb4 UTSW 1 68330238 missense probably benign 0.02
R5068:Erbb4 UTSW 1 68043902 splice site probably null
R5546:Erbb4 UTSW 1 68298293 missense probably damaging 0.99
R5755:Erbb4 UTSW 1 68560519 missense possibly damaging 0.96
R6189:Erbb4 UTSW 1 68043916 missense probably benign
R6257:Erbb4 UTSW 1 68396273 missense probably damaging 1.00
R6276:Erbb4 UTSW 1 68560576 missense probably damaging 1.00
R6521:Erbb4 UTSW 1 68042530 missense probably damaging 1.00
R6602:Erbb4 UTSW 1 68370503 missense probably damaging 0.99
R6808:Erbb4 UTSW 1 68040303 missense probably benign 0.00
R7087:Erbb4 UTSW 1 68740491 missense probably null 1.00
R7215:Erbb4 UTSW 1 68339460 missense probably benign
R7356:Erbb4 UTSW 1 68339355 critical splice donor site probably null
R7509:Erbb4 UTSW 1 68250580 missense possibly damaging 0.67
R7593:Erbb4 UTSW 1 68254599 missense probably damaging 0.99
R7743:Erbb4 UTSW 1 68328119 missense probably benign 0.00
R7784:Erbb4 UTSW 1 68075499 missense probably damaging 1.00
R7815:Erbb4 UTSW 1 68042726 missense probably damaging 1.00
X0019:Erbb4 UTSW 1 68073145 missense probably benign 0.00
Z1176:Erbb4 UTSW 1 68298402 frame shift probably null
Z1176:Erbb4 UTSW 1 68328259 nonsense probably null
Z1177:Erbb4 UTSW 1 68259183 frame shift probably null
Z1177:Erbb4 UTSW 1 68290476 missense probably damaging 1.00
Z1177:Erbb4 UTSW 1 68309643 missense probably benign 0.06
Predicted Primers PCR Primer
(F):5'- TAGAGTGTACTTCTGTTCAGCTGAG -3'
(R):5'- AGACTGTGTTACAACCTGTCAAG -3'

Sequencing Primer
(F):5'- CTTTCTCATGAAACGAGCATGCAG -3'
(R):5'- GTGTTACAACCTGTCAAGTTAATTTC -3'
Posted On2015-04-29