Incidental Mutation 'R4012:Atg16l1'
ID311724
Institutional Source Beutler Lab
Gene Symbol Atg16l1
Ensembl Gene ENSMUSG00000026289
Gene Nameautophagy related 16-like 1 (S. cerevisiae)
Synonyms1500009K01Rik, APG16L, WDR30
MMRRC Submission 040949-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4012 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location87755870-87792428 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 87766907 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 102 (D102G)
Ref Sequence ENSEMBL: ENSMUSP00000120955 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027512] [ENSMUST00000113186] [ENSMUST00000113190] [ENSMUST00000144047]
Predicted Effect probably damaging
Transcript: ENSMUST00000027512
AA Change: D164G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000027512
Gene: ENSMUSG00000026289
AA Change: D164G

DomainStartEndE-ValueType
Pfam:ATG16 13 207 1.3e-63 PFAM
low complexity region 237 246 N/A INTRINSIC
WD40 311 350 7.05e-9 SMART
WD40 355 394 7.28e-2 SMART
WD40 397 436 1.07e-8 SMART
WD40 439 475 3.7e0 SMART
WD40 478 516 5.35e-1 SMART
WD40 519 562 1.2e-2 SMART
WD40 565 605 6.89e-3 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000113186
AA Change: D164G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000108811
Gene: ENSMUSG00000026289
AA Change: D164G

DomainStartEndE-ValueType
Pfam:ATG16 13 207 3.7e-64 PFAM
low complexity region 237 246 N/A INTRINSIC
low complexity region 257 271 N/A INTRINSIC
WD40 292 331 7.05e-9 SMART
WD40 336 375 7.28e-2 SMART
WD40 378 417 1.07e-8 SMART
WD40 420 456 3.7e0 SMART
WD40 459 497 5.35e-1 SMART
WD40 500 543 1.2e-2 SMART
WD40 546 586 6.89e-3 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000113190
AA Change: D164G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000108815
Gene: ENSMUSG00000026289
AA Change: D164G

DomainStartEndE-ValueType
Pfam:ATG16 16 206 6.5e-49 PFAM
low complexity region 237 246 N/A INTRINSIC
low complexity region 295 306 N/A INTRINSIC
WD40 327 366 7.05e-9 SMART
WD40 371 410 7.28e-2 SMART
WD40 413 452 1.07e-8 SMART
WD40 455 491 3.7e0 SMART
WD40 494 532 5.35e-1 SMART
WD40 535 578 1.2e-2 SMART
WD40 581 621 6.89e-3 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129431
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133072
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134603
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137638
Predicted Effect probably damaging
Transcript: ENSMUST00000144047
AA Change: D102G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000120955
Gene: ENSMUSG00000026289
AA Change: D102G

DomainStartEndE-ValueType
Pfam:ATG16 1 145 2.9e-50 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151037
Meta Mutation Damage Score 0.3841 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 93.0%
Validation Efficiency 100% (79/79)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is part of a large protein complex that is necessary for autophagy, the major process by which intracellular components are targeted to lysosomes for degradation. Defects in this gene are a cause of susceptibility to inflammatory bowel disease type 10 (IBD10). Several transcript variants encoding different isoforms have been found for this gene.[provided by RefSeq, Jun 2010]
PHENOTYPE: Null homozygotes have a cellular defect in autophagy that results in lethality during the neonatal starvation period. Mice homozygous for hypomorphic alleles have Paneth cells with aberrant, disorganized granules similar to those found in patients with Crohn's disease. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 79 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700015F17Rik A C 5: 5,478,955 L20R probably damaging Het
2210016F16Rik T A 13: 58,381,986 K271* probably null Het
9930021J03Rik T G 19: 29,743,590 K622N probably damaging Het
Adnp2 G T 18: 80,130,821 F124L probably benign Het
Aicda A G 6: 122,559,490 K10E probably benign Het
Als2 A G 1: 59,187,416 C910R probably benign Het
Ankrd11 T A 8: 122,892,417 K1565N probably damaging Het
Apol7b T C 15: 77,424,709 D63G probably damaging Het
Arhgef4 T C 1: 34,725,106 C1148R possibly damaging Het
Babam2 T C 5: 32,001,438 V244A probably damaging Het
Cars G A 7: 143,559,674 A668V possibly damaging Het
Ccdc185 T A 1: 182,748,888 S79C possibly damaging Het
Ccdc88b G C 19: 6,848,991 R1119G probably damaging Het
Cebpz A T 17: 78,924,467 V810E probably damaging Het
Cep120 T C 18: 53,738,582 T73A probably damaging Het
Chat C A 14: 32,423,312 C380F possibly damaging Het
Cltc T C 11: 86,757,261 Q10R probably benign Het
Cst8 T C 2: 148,804,702 probably benign Het
Cts3 C T 13: 61,568,054 probably null Het
Cyp4a29 T A 4: 115,248,510 D136E probably benign Het
Dmxl2 A C 9: 54,379,013 probably null Het
Dsg4 T A 18: 20,451,862 V211E possibly damaging Het
Efcab5 C T 11: 77,117,830 V957I probably damaging Het
Eif4g2 A T 7: 111,074,151 L807Q possibly damaging Het
Epha4 A G 1: 77,390,094 probably benign Het
Epm2aip1 A T 9: 111,272,390 I144F probably benign Het
Erbb4 C T 1: 68,560,576 R114H probably damaging Het
Fabp3 C T 4: 130,312,387 T57I probably benign Het
Fam170a C T 18: 50,281,971 A228V probably damaging Het
Foxred1 A T 9: 35,206,275 M254K possibly damaging Het
Gm1527 T A 3: 28,898,820 C90S probably benign Het
Gm16286 A G 18: 80,212,124 D211G probably benign Het
Gm8251 T C 1: 44,060,969 D323G possibly damaging Het
Gpr137b T C 13: 13,359,362 T370A probably benign Het
Gtf2e2 A G 8: 33,755,965 probably benign Het
Hgsnat A T 8: 25,955,789 L359* probably null Het
Hhip A T 8: 79,992,594 C435S probably damaging Het
Hoxa13 T C 6: 52,259,127 D310G possibly damaging Het
Hspa14 T C 2: 3,512,638 Y18C probably damaging Het
Ighg1 A G 12: 113,329,650 V140A probably damaging Het
Ighv1-58 A T 12: 115,312,310 Y69* probably null Het
Inpp5j A G 11: 3,500,185 F615L probably benign Het
Kcna1 T A 6: 126,642,910 Y149F probably benign Het
Kcnj6 A T 16: 94,825,018 probably null Het
Krtap4-1 G T 11: 99,627,811 C124* probably null Het
Lama1 T A 17: 67,812,373 L2615* probably null Het
Lcp2 A T 11: 34,068,439 I72F probably damaging Het
Med1 T A 11: 98,171,706 I189F possibly damaging Het
Meioc C T 11: 102,675,828 R757C probably damaging Het
Mtr T A 13: 12,189,397 H1171L probably damaging Het
Mtr G C 13: 12,189,398 H1171D probably damaging Het
Nlrc5 A G 8: 94,475,992 Y240C possibly damaging Het
Nsun4 T A 4: 116,051,062 H767L possibly damaging Het
Pcdha1 T A 18: 36,931,136 N284K probably benign Het
Pcdhgb8 A C 18: 37,763,361 S495R probably benign Het
Pramel1 T A 4: 143,396,690 I79N possibly damaging Het
Prdm6 A T 18: 53,540,318 E183D possibly damaging Het
Prex2 T C 1: 11,184,516 F1125L probably benign Het
Prkg2 T C 5: 98,979,815 I346V possibly damaging Het
Ptprz1 A G 6: 23,002,585 D1558G probably damaging Het
Rab11fip3 GCTCGTCT GCT 17: 26,068,028 probably null Het
Rin2 C T 2: 145,860,446 T354I probably benign Het
S100a6 A G 3: 90,614,201 D50G probably damaging Het
Shroom3 T A 5: 92,948,483 probably benign Het
Sipa1l1 G A 12: 82,341,782 V261M possibly damaging Het
Slc5a4b T A 10: 76,074,992 I337F probably damaging Het
Smarcc1 A G 9: 110,132,205 Y30C possibly damaging Het
Swap70 A G 7: 110,281,305 K576E possibly damaging Het
Syt6 A G 3: 103,625,493 probably benign Het
Szt2 T C 4: 118,383,900 I1726V probably benign Het
Tdgf1 C T 9: 110,940,713 M169I probably benign Het
Thoc1 A G 18: 9,987,651 K453E possibly damaging Het
Tmem38b A G 4: 53,854,409 I214V probably benign Het
Tonsl A T 15: 76,637,044 I354N probably damaging Het
Trappc9 T C 15: 73,031,623 I303V possibly damaging Het
Trim66 A G 7: 109,458,131 S1032P probably damaging Het
Tsc22d4 T C 5: 137,758,328 V6A probably benign Het
Ubtd2 A G 11: 32,499,260 K36E probably benign Het
Zkscan2 T C 7: 123,498,660 E171G possibly damaging Het
Other mutations in Atg16l1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00092:Atg16l1 APN 1 87765397 missense possibly damaging 0.68
IGL00861:Atg16l1 APN 1 87774838 missense probably damaging 1.00
IGL01065:Atg16l1 APN 1 87785931 missense probably damaging 0.99
IGL01068:Atg16l1 APN 1 87774824 missense probably damaging 1.00
IGL01140:Atg16l1 APN 1 87774853 missense probably benign 0.03
R0023:Atg16l1 UTSW 1 87789465 missense probably benign 0.00
R0023:Atg16l1 UTSW 1 87789465 missense probably benign 0.00
R0650:Atg16l1 UTSW 1 87781699 missense possibly damaging 0.93
R0655:Atg16l1 UTSW 1 87766829 missense probably damaging 1.00
R1421:Atg16l1 UTSW 1 87786358 splice site probably benign
R1549:Atg16l1 UTSW 1 87774188 missense probably benign
R2202:Atg16l1 UTSW 1 87767015 missense probably benign 0.03
R2204:Atg16l1 UTSW 1 87767015 missense probably benign 0.03
R3689:Atg16l1 UTSW 1 87785904 missense probably damaging 1.00
R4391:Atg16l1 UTSW 1 87760120 missense probably damaging 0.97
R4839:Atg16l1 UTSW 1 87766174 missense probably damaging 0.99
R4935:Atg16l1 UTSW 1 87767042 missense possibly damaging 0.69
R4980:Atg16l1 UTSW 1 87766831 missense possibly damaging 0.89
R4990:Atg16l1 UTSW 1 87789369 missense probably benign 0.00
R5011:Atg16l1 UTSW 1 87774180 nonsense probably null
R5457:Atg16l1 UTSW 1 87775091 missense probably damaging 0.96
R5897:Atg16l1 UTSW 1 87785997 critical splice donor site probably null
R6289:Atg16l1 UTSW 1 87756215 missense probably damaging 0.99
R6437:Atg16l1 UTSW 1 87790648 missense probably damaging 1.00
R6727:Atg16l1 UTSW 1 87774854 missense possibly damaging 0.68
R6923:Atg16l1 UTSW 1 87774356 intron probably null
R7423:Atg16l1 UTSW 1 87786301 missense probably damaging 1.00
R7475:Atg16l1 UTSW 1 87760083 missense possibly damaging 0.89
Predicted Primers PCR Primer
(F):5'- AGCTAGATGGACCAGGTGTG -3'
(R):5'- GTCCACTAACTGCAGCTAGATGTC -3'

Sequencing Primer
(F):5'- GGCCAGTGTTCCCATTGCTG -3'
(R):5'- TAGATGTCCCACCTGGAGTC -3'
Posted On2015-04-29