Incidental Mutation 'R4012:Rin2'
ID311727
Institutional Source Beutler Lab
Gene Symbol Rin2
Ensembl Gene ENSMUSG00000001768
Gene NameRas and Rab interactor 2
SynonymsRASSF4, 4632403N06Rik, 2010003K16Rik
MMRRC Submission 040949-MU
Accession Numbers

Genbank: NM_028724; MGI: 1921280; Ensembl: ENSMUST00000110005

Is this an essential gene? Probably non essential (E-score: 0.200) question?
Stock #R4012 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location145675215-145887616 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 145860446 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Isoleucine at position 354 (T354I)
Ref Sequence ENSEMBL: ENSMUSP00000105632 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000094480] [ENSMUST00000110005] [ENSMUST00000147976]
Predicted Effect probably benign
Transcript: ENSMUST00000094480
AA Change: T309I

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000092053
Gene: ENSMUSG00000001768
AA Change: T309I

DomainStartEndE-ValueType
SH2 50 136 1.38e-3 SMART
low complexity region 175 187 N/A INTRINSIC
low complexity region 258 269 N/A INTRINSIC
low complexity region 335 352 N/A INTRINSIC
low complexity region 375 385 N/A INTRINSIC
low complexity region 393 411 N/A INTRINSIC
Blast:SH2 540 576 2e-7 BLAST
VPS9 612 730 1.72e-68 SMART
RA 751 842 3.35e-24 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000110005
AA Change: T354I

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000105632
Gene: ENSMUSG00000001768
AA Change: T354I

DomainStartEndE-ValueType
SH2 95 181 1.38e-3 SMART
low complexity region 220 232 N/A INTRINSIC
low complexity region 303 314 N/A INTRINSIC
low complexity region 380 397 N/A INTRINSIC
low complexity region 420 430 N/A INTRINSIC
low complexity region 438 456 N/A INTRINSIC
Blast:SH2 585 621 2e-7 BLAST
VPS9 657 775 1.72e-68 SMART
RA 796 887 3.35e-24 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145874
Predicted Effect probably benign
Transcript: ENSMUST00000147976
Meta Mutation Damage Score 0.0630 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 93.0%
Validation Efficiency 100% (79/79)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The RAB5 protein is a small GTPase involved in membrane trafficking in the early endocytic pathway. The protein encoded by this gene binds the GTP-bound form of the RAB5 protein preferentially over the GDP-bound form, and functions as a guanine nucleotide exchange factor for RAB5. The encoded protein is found primarily as a tetramer in the cytoplasm and does not bind other members of the RAB family. Mutations in this gene cause macrocephaly alopecia cutis laxa and scoliosis (MACS) syndrome, an elastic tissue disorder, as well as the related connective tissue disorder, RIN2 syndrome. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jun 2011]
Allele List at MGI

All alleles(3) : Targeted, other(2) Gene trapped(1)

Other mutations in this stock
Total: 79 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700015F17Rik A C 5: 5,478,955 L20R probably damaging Het
2210016F16Rik T A 13: 58,381,986 K271* probably null Het
9930021J03Rik T G 19: 29,743,590 K622N probably damaging Het
Adnp2 G T 18: 80,130,821 F124L probably benign Het
Aicda A G 6: 122,559,490 K10E probably benign Het
Als2 A G 1: 59,187,416 C910R probably benign Het
Ankrd11 T A 8: 122,892,417 K1565N probably damaging Het
Apol7b T C 15: 77,424,709 D63G probably damaging Het
Arhgef4 T C 1: 34,725,106 C1148R possibly damaging Het
Atg16l1 A G 1: 87,766,907 D102G probably damaging Het
Babam2 T C 5: 32,001,438 V244A probably damaging Het
Cars G A 7: 143,559,674 A668V possibly damaging Het
Ccdc185 T A 1: 182,748,888 S79C possibly damaging Het
Ccdc88b G C 19: 6,848,991 R1119G probably damaging Het
Cebpz A T 17: 78,924,467 V810E probably damaging Het
Cep120 T C 18: 53,738,582 T73A probably damaging Het
Chat C A 14: 32,423,312 C380F possibly damaging Het
Cltc T C 11: 86,757,261 Q10R probably benign Het
Cst8 T C 2: 148,804,702 probably benign Het
Cts3 C T 13: 61,568,054 probably null Het
Cyp4a29 T A 4: 115,248,510 D136E probably benign Het
Dmxl2 A C 9: 54,379,013 probably null Het
Dsg4 T A 18: 20,451,862 V211E possibly damaging Het
Efcab5 C T 11: 77,117,830 V957I probably damaging Het
Eif4g2 A T 7: 111,074,151 L807Q possibly damaging Het
Epha4 A G 1: 77,390,094 probably benign Het
Epm2aip1 A T 9: 111,272,390 I144F probably benign Het
Erbb4 C T 1: 68,560,576 R114H probably damaging Het
Fabp3 C T 4: 130,312,387 T57I probably benign Het
Fam170a C T 18: 50,281,971 A228V probably damaging Het
Foxred1 A T 9: 35,206,275 M254K possibly damaging Het
Gm1527 T A 3: 28,898,820 C90S probably benign Het
Gm16286 A G 18: 80,212,124 D211G probably benign Het
Gm8251 T C 1: 44,060,969 D323G possibly damaging Het
Gpr137b T C 13: 13,359,362 T370A probably benign Het
Gtf2e2 A G 8: 33,755,965 probably benign Het
Hgsnat A T 8: 25,955,789 L359* probably null Het
Hhip A T 8: 79,992,594 C435S probably damaging Het
Hoxa13 T C 6: 52,259,127 D310G possibly damaging Het
Hspa14 T C 2: 3,512,638 Y18C probably damaging Het
Ighg1 A G 12: 113,329,650 V140A probably damaging Het
Ighv1-58 A T 12: 115,312,310 Y69* probably null Het
Inpp5j A G 11: 3,500,185 F615L probably benign Het
Kcna1 T A 6: 126,642,910 Y149F probably benign Het
Kcnj6 A T 16: 94,825,018 probably null Het
Krtap4-1 G T 11: 99,627,811 C124* probably null Het
Lama1 T A 17: 67,812,373 L2615* probably null Het
Lcp2 A T 11: 34,068,439 I72F probably damaging Het
Med1 T A 11: 98,171,706 I189F possibly damaging Het
Meioc C T 11: 102,675,828 R757C probably damaging Het
Mtr T A 13: 12,189,397 H1171L probably damaging Het
Mtr G C 13: 12,189,398 H1171D probably damaging Het
Nlrc5 A G 8: 94,475,992 Y240C possibly damaging Het
Nsun4 T A 4: 116,051,062 H767L possibly damaging Het
Pcdha1 T A 18: 36,931,136 N284K probably benign Het
Pcdhgb8 A C 18: 37,763,361 S495R probably benign Het
Pramel1 T A 4: 143,396,690 I79N possibly damaging Het
Prdm6 A T 18: 53,540,318 E183D possibly damaging Het
Prex2 T C 1: 11,184,516 F1125L probably benign Het
Prkg2 T C 5: 98,979,815 I346V possibly damaging Het
Ptprz1 A G 6: 23,002,585 D1558G probably damaging Het
Rab11fip3 GCTCGTCT GCT 17: 26,068,028 probably null Het
S100a6 A G 3: 90,614,201 D50G probably damaging Het
Shroom3 T A 5: 92,948,483 probably benign Het
Sipa1l1 G A 12: 82,341,782 V261M possibly damaging Het
Slc5a4b T A 10: 76,074,992 I337F probably damaging Het
Smarcc1 A G 9: 110,132,205 Y30C possibly damaging Het
Swap70 A G 7: 110,281,305 K576E possibly damaging Het
Syt6 A G 3: 103,625,493 probably benign Het
Szt2 T C 4: 118,383,900 I1726V probably benign Het
Tdgf1 C T 9: 110,940,713 M169I probably benign Het
Thoc1 A G 18: 9,987,651 K453E possibly damaging Het
Tmem38b A G 4: 53,854,409 I214V probably benign Het
Tonsl A T 15: 76,637,044 I354N probably damaging Het
Trappc9 T C 15: 73,031,623 I303V possibly damaging Het
Trim66 A G 7: 109,458,131 S1032P probably damaging Het
Tsc22d4 T C 5: 137,758,328 V6A probably benign Het
Ubtd2 A G 11: 32,499,260 K36E probably benign Het
Zkscan2 T C 7: 123,498,660 E171G possibly damaging Het
Other mutations in Rin2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02928:Rin2 APN 2 145860006 splice site probably benign
IGL03222:Rin2 APN 2 145860195 nonsense probably null
IGL03371:Rin2 APN 2 145885926 utr 3 prime probably benign
IGL03411:Rin2 APN 2 145860944 missense probably damaging 0.99
D4043:Rin2 UTSW 2 145822363 missense possibly damaging 0.61
R0025:Rin2 UTSW 2 145878832 splice site probably benign
R0110:Rin2 UTSW 2 145861033 missense probably benign
R0144:Rin2 UTSW 2 145876639 missense probably damaging 0.96
R0510:Rin2 UTSW 2 145861033 missense probably benign
R1326:Rin2 UTSW 2 145860446 missense probably benign 0.00
R1327:Rin2 UTSW 2 145860446 missense probably benign 0.00
R1328:Rin2 UTSW 2 145860446 missense probably benign 0.00
R1329:Rin2 UTSW 2 145860446 missense probably benign 0.00
R1330:Rin2 UTSW 2 145860446 missense probably benign 0.00
R1544:Rin2 UTSW 2 145858446 missense probably damaging 1.00
R1658:Rin2 UTSW 2 145876456 missense probably benign 0.04
R1832:Rin2 UTSW 2 145861171 missense possibly damaging 0.48
R1986:Rin2 UTSW 2 145878940 missense probably damaging 1.00
R2137:Rin2 UTSW 2 145860446 missense probably benign 0.00
R2167:Rin2 UTSW 2 145860446 missense probably benign 0.00
R2170:Rin2 UTSW 2 145860446 missense probably benign 0.00
R2260:Rin2 UTSW 2 145878904 missense probably damaging 0.97
R2312:Rin2 UTSW 2 145860446 missense probably benign 0.00
R2884:Rin2 UTSW 2 145860991 missense probably benign 0.07
R3155:Rin2 UTSW 2 145860851 missense probably benign 0.17
R3771:Rin2 UTSW 2 145860446 missense probably benign 0.00
R3772:Rin2 UTSW 2 145860446 missense probably benign 0.00
R3773:Rin2 UTSW 2 145860446 missense probably benign 0.00
R3822:Rin2 UTSW 2 145822630 missense probably benign 0.02
R3824:Rin2 UTSW 2 145860446 missense probably benign 0.00
R3825:Rin2 UTSW 2 145860446 missense probably benign 0.00
R3885:Rin2 UTSW 2 145860446 missense probably benign 0.00
R3893:Rin2 UTSW 2 145860446 missense probably benign 0.00
R3939:Rin2 UTSW 2 145860446 missense probably benign 0.00
R3940:Rin2 UTSW 2 145860446 missense probably benign 0.00
R4019:Rin2 UTSW 2 145860446 missense probably benign 0.00
R4058:Rin2 UTSW 2 145860446 missense probably benign 0.00
R4214:Rin2 UTSW 2 145860446 missense probably benign 0.00
R4231:Rin2 UTSW 2 145860446 missense probably benign 0.00
R4232:Rin2 UTSW 2 145860446 missense probably benign 0.00
R4236:Rin2 UTSW 2 145860446 missense probably benign 0.00
R4372:Rin2 UTSW 2 145860446 missense probably benign 0.00
R4410:Rin2 UTSW 2 145860446 missense probably benign 0.00
R4415:Rin2 UTSW 2 145860446 missense probably benign 0.00
R4471:Rin2 UTSW 2 145860446 missense probably benign 0.00
R4490:Rin2 UTSW 2 145822274 missense possibly damaging 0.66
R4597:Rin2 UTSW 2 145860905 missense probably benign 0.01
R5099:Rin2 UTSW 2 145878901 missense probably damaging 1.00
R5268:Rin2 UTSW 2 145844760 missense probably benign
R5493:Rin2 UTSW 2 145860709 missense probably damaging 1.00
R5622:Rin2 UTSW 2 145860379 missense probably benign 0.07
R5947:Rin2 UTSW 2 145844943 intron probably benign
R6280:Rin2 UTSW 2 145861019 missense probably damaging 1.00
R7009:Rin2 UTSW 2 145883475 missense probably damaging 1.00
R7531:Rin2 UTSW 2 145858499 missense probably benign
R7824:Rin2 UTSW 2 145861117 missense probably benign 0.00
R8065:Rin2 UTSW 2 145861057 missense probably damaging 0.99
R8067:Rin2 UTSW 2 145861057 missense probably damaging 0.99
R8144:Rin2 UTSW 2 145822305 missense probably benign
Predicted Primers PCR Primer
(F):5'- AAGGACTCCCAACGCGAATG -3'
(R):5'- AGTGGAAAGGCTCATGTCGC -3'

Sequencing Primer
(F):5'- GAATGGCACCGAGAGACCTC -3'
(R):5'- AAAGGCTCATGTCGCTCAGC -3'
Posted On2015-04-29