Incidental Mutation 'R4012:Tmem38b'
ID311732
Institutional Source Beutler Lab
Gene Symbol Tmem38b
Ensembl Gene ENSMUSG00000028420
Gene Nametransmembrane protein 38B
Synonyms1600017F22Rik, TRIC-B, D4Ertd89e
MMRRC Submission 040949-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4012 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location53826045-53862019 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 53854409 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 214 (I214V)
Ref Sequence ENSEMBL: ENSMUSP00000030127 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030127] [ENSMUST00000144167]
Predicted Effect probably benign
Transcript: ENSMUST00000030127
AA Change: I214V

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000030127
Gene: ENSMUSG00000028420
AA Change: I214V

DomainStartEndE-ValueType
Pfam:TRIC 36 227 4.1e-81 PFAM
low complexity region 249 256 N/A INTRINSIC
low complexity region 265 274 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000144167
SMART Domains Protein: ENSMUSP00000120304
Gene: ENSMUSG00000028420

DomainStartEndE-ValueType
Pfam:TRIC 9 164 3.1e-77 PFAM
Meta Mutation Damage Score 0.0713 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 93.0%
Validation Efficiency 100% (79/79)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an intracellular monovalent cation channel that functions in maintenance of intracellular calcium release. Mutations in this gene may be associated with autosomal recessive osteogenesis. [provided by RefSeq, Oct 2012]
PHENOTYPE: Homozygous null newborn mice die of respiratory failure showing atelectasis, pulmonary congestion, impaired maturation of alveolar type II cells, reduced lamellar body formation, abnormal synthesis and secretion of surfactant phospholipids, and impaired Ca2+ release in alveolar type II cells. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 79 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700015F17Rik A C 5: 5,478,955 L20R probably damaging Het
2210016F16Rik T A 13: 58,381,986 K271* probably null Het
9930021J03Rik T G 19: 29,743,590 K622N probably damaging Het
Adnp2 G T 18: 80,130,821 F124L probably benign Het
Aicda A G 6: 122,559,490 K10E probably benign Het
Als2 A G 1: 59,187,416 C910R probably benign Het
Ankrd11 T A 8: 122,892,417 K1565N probably damaging Het
Apol7b T C 15: 77,424,709 D63G probably damaging Het
Arhgef4 T C 1: 34,725,106 C1148R possibly damaging Het
Atg16l1 A G 1: 87,766,907 D102G probably damaging Het
Babam2 T C 5: 32,001,438 V244A probably damaging Het
Cars G A 7: 143,559,674 A668V possibly damaging Het
Ccdc185 T A 1: 182,748,888 S79C possibly damaging Het
Ccdc88b G C 19: 6,848,991 R1119G probably damaging Het
Cebpz A T 17: 78,924,467 V810E probably damaging Het
Cep120 T C 18: 53,738,582 T73A probably damaging Het
Chat C A 14: 32,423,312 C380F possibly damaging Het
Cltc T C 11: 86,757,261 Q10R probably benign Het
Cst8 T C 2: 148,804,702 probably benign Het
Cts3 C T 13: 61,568,054 probably null Het
Cyp4a29 T A 4: 115,248,510 D136E probably benign Het
Dmxl2 A C 9: 54,379,013 probably null Het
Dsg4 T A 18: 20,451,862 V211E possibly damaging Het
Efcab5 C T 11: 77,117,830 V957I probably damaging Het
Eif4g2 A T 7: 111,074,151 L807Q possibly damaging Het
Epha4 A G 1: 77,390,094 probably benign Het
Epm2aip1 A T 9: 111,272,390 I144F probably benign Het
Erbb4 C T 1: 68,560,576 R114H probably damaging Het
Fabp3 C T 4: 130,312,387 T57I probably benign Het
Fam170a C T 18: 50,281,971 A228V probably damaging Het
Foxred1 A T 9: 35,206,275 M254K possibly damaging Het
Gm1527 T A 3: 28,898,820 C90S probably benign Het
Gm16286 A G 18: 80,212,124 D211G probably benign Het
Gm8251 T C 1: 44,060,969 D323G possibly damaging Het
Gpr137b T C 13: 13,359,362 T370A probably benign Het
Gtf2e2 A G 8: 33,755,965 probably benign Het
Hgsnat A T 8: 25,955,789 L359* probably null Het
Hhip A T 8: 79,992,594 C435S probably damaging Het
Hoxa13 T C 6: 52,259,127 D310G possibly damaging Het
Hspa14 T C 2: 3,512,638 Y18C probably damaging Het
Ighg1 A G 12: 113,329,650 V140A probably damaging Het
Ighv1-58 A T 12: 115,312,310 Y69* probably null Het
Inpp5j A G 11: 3,500,185 F615L probably benign Het
Kcna1 T A 6: 126,642,910 Y149F probably benign Het
Kcnj6 A T 16: 94,825,018 probably null Het
Krtap4-1 G T 11: 99,627,811 C124* probably null Het
Lama1 T A 17: 67,812,373 L2615* probably null Het
Lcp2 A T 11: 34,068,439 I72F probably damaging Het
Med1 T A 11: 98,171,706 I189F possibly damaging Het
Meioc C T 11: 102,675,828 R757C probably damaging Het
Mtr T A 13: 12,189,397 H1171L probably damaging Het
Mtr G C 13: 12,189,398 H1171D probably damaging Het
Nlrc5 A G 8: 94,475,992 Y240C possibly damaging Het
Nsun4 T A 4: 116,051,062 H767L possibly damaging Het
Pcdha1 T A 18: 36,931,136 N284K probably benign Het
Pcdhgb8 A C 18: 37,763,361 S495R probably benign Het
Pramel1 T A 4: 143,396,690 I79N possibly damaging Het
Prdm6 A T 18: 53,540,318 E183D possibly damaging Het
Prex2 T C 1: 11,184,516 F1125L probably benign Het
Prkg2 T C 5: 98,979,815 I346V possibly damaging Het
Ptprz1 A G 6: 23,002,585 D1558G probably damaging Het
Rab11fip3 GCTCGTCT GCT 17: 26,068,028 probably null Het
Rin2 C T 2: 145,860,446 T354I probably benign Het
S100a6 A G 3: 90,614,201 D50G probably damaging Het
Shroom3 T A 5: 92,948,483 probably benign Het
Sipa1l1 G A 12: 82,341,782 V261M possibly damaging Het
Slc5a4b T A 10: 76,074,992 I337F probably damaging Het
Smarcc1 A G 9: 110,132,205 Y30C possibly damaging Het
Swap70 A G 7: 110,281,305 K576E possibly damaging Het
Syt6 A G 3: 103,625,493 probably benign Het
Szt2 T C 4: 118,383,900 I1726V probably benign Het
Tdgf1 C T 9: 110,940,713 M169I probably benign Het
Thoc1 A G 18: 9,987,651 K453E possibly damaging Het
Tonsl A T 15: 76,637,044 I354N probably damaging Het
Trappc9 T C 15: 73,031,623 I303V possibly damaging Het
Trim66 A G 7: 109,458,131 S1032P probably damaging Het
Tsc22d4 T C 5: 137,758,328 V6A probably benign Het
Ubtd2 A G 11: 32,499,260 K36E probably benign Het
Zkscan2 T C 7: 123,498,660 E171G possibly damaging Het
Other mutations in Tmem38b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01068:Tmem38b APN 4 53849024 missense probably damaging 1.00
IGL01948:Tmem38b APN 4 53850530 missense probably damaging 0.97
IGL02383:Tmem38b APN 4 53854345 missense probably benign
IGL02619:Tmem38b APN 4 53848871 missense probably damaging 1.00
R0266:Tmem38b UTSW 4 53840765 missense probably damaging 1.00
R0849:Tmem38b UTSW 4 53840765 missense probably damaging 1.00
R1658:Tmem38b UTSW 4 53840713 missense probably benign
R3845:Tmem38b UTSW 4 53859905 missense probably benign 0.10
R3930:Tmem38b UTSW 4 53854398 missense probably damaging 1.00
R4233:Tmem38b UTSW 4 53840710 missense probably damaging 1.00
R4235:Tmem38b UTSW 4 53840710 missense probably damaging 1.00
R5388:Tmem38b UTSW 4 53859945 missense probably benign 0.04
R5708:Tmem38b UTSW 4 53849051 critical splice donor site probably null
R6083:Tmem38b UTSW 4 53840765 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GAGCACTCTGAGAAGATTGTAGAC -3'
(R):5'- TGACTTCCAAGACACTGCC -3'

Sequencing Primer
(F):5'- CACTCTGAGAAGATTGTAGACAGAGC -3'
(R):5'- TCTCCTGATGGCAGTGAAAAAC -3'
Posted On2015-04-29