Incidental Mutation 'R4012:Shroom3'
ID 311739
Institutional Source Beutler Lab
Gene Symbol Shroom3
Ensembl Gene ENSMUSG00000029381
Gene Name shroom family member 3
Synonyms Shrm3, D5Ertd287e, Shrm
MMRRC Submission 040949-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R4012 (G1)
Quality Score 225
Status Validated
Chromosome 5
Chromosomal Location 92831294-93113177 bp(+) (GRCm39)
Type of Mutation splice site
DNA Base Change (assembly) T to A at 93096342 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000153516 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000113051] [ENSMUST00000113054] [ENSMUST00000113055] [ENSMUST00000168878] [ENSMUST00000225438]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000113051
SMART Domains Protein: ENSMUSP00000108674
Gene: ENSMUSG00000029381

DomainStartEndE-ValueType
low complexity region 16 27 N/A INTRINSIC
low complexity region 83 93 N/A INTRINSIC
low complexity region 572 586 N/A INTRINSIC
low complexity region 621 639 N/A INTRINSIC
low complexity region 685 704 N/A INTRINSIC
Pfam:ASD1 706 885 2.3e-65 PFAM
low complexity region 939 952 N/A INTRINSIC
low complexity region 1132 1143 N/A INTRINSIC
low complexity region 1172 1184 N/A INTRINSIC
low complexity region 1274 1288 N/A INTRINSIC
low complexity region 1333 1345 N/A INTRINSIC
Pfam:ASD2 1478 1765 3.1e-107 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000113054
SMART Domains Protein: ENSMUSP00000108677
Gene: ENSMUSG00000029381

DomainStartEndE-ValueType
low complexity region 16 27 N/A INTRINSIC
low complexity region 83 93 N/A INTRINSIC
low complexity region 572 586 N/A INTRINSIC
low complexity region 621 639 N/A INTRINSIC
low complexity region 685 704 N/A INTRINSIC
Pfam:ASD1 706 885 2.3e-65 PFAM
low complexity region 939 952 N/A INTRINSIC
low complexity region 1132 1143 N/A INTRINSIC
low complexity region 1172 1184 N/A INTRINSIC
low complexity region 1274 1288 N/A INTRINSIC
low complexity region 1333 1345 N/A INTRINSIC
Pfam:ASD2 1478 1765 3.1e-107 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000113055
SMART Domains Protein: ENSMUSP00000108678
Gene: ENSMUSG00000029381

DomainStartEndE-ValueType
PDZ 35 109 5.81e-11 SMART
low complexity region 191 202 N/A INTRINSIC
low complexity region 258 268 N/A INTRINSIC
low complexity region 747 761 N/A INTRINSIC
low complexity region 796 814 N/A INTRINSIC
low complexity region 860 879 N/A INTRINSIC
Pfam:ASD1 882 1060 1e-57 PFAM
low complexity region 1114 1127 N/A INTRINSIC
low complexity region 1307 1318 N/A INTRINSIC
low complexity region 1347 1359 N/A INTRINSIC
low complexity region 1449 1463 N/A INTRINSIC
low complexity region 1508 1520 N/A INTRINSIC
Pfam:ASD2 1654 1940 9.9e-112 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000168878
SMART Domains Protein: ENSMUSP00000130419
Gene: ENSMUSG00000029381

DomainStartEndE-ValueType
PDZ 35 109 5.81e-11 SMART
low complexity region 191 202 N/A INTRINSIC
low complexity region 258 268 N/A INTRINSIC
low complexity region 747 761 N/A INTRINSIC
low complexity region 796 814 N/A INTRINSIC
low complexity region 860 879 N/A INTRINSIC
low complexity region 983 996 N/A INTRINSIC
low complexity region 1176 1187 N/A INTRINSIC
low complexity region 1216 1228 N/A INTRINSIC
low complexity region 1318 1332 N/A INTRINSIC
low complexity region 1377 1389 N/A INTRINSIC
Pfam:ASD2 1522 1809 8.9e-108 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000200869
Predicted Effect probably benign
Transcript: ENSMUST00000225438
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 93.0%
Validation Efficiency 100% (79/79)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a PDZ-domain-containing protein that belongs to a family of Shroom-related proteins. This protein may be involved in regulating cell shape in certain tissues. A similar protein in mice is required for proper neurulation. [provided by RefSeq, Jan 2011]
PHENOTYPE: Homozygous mutation of this locus results in failed neural tube closure leading to exencephaly, acrania, facial clefting, and spina bifida. Homozygotes develop to term but die either at birth or shortly thereafter. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 79 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adnp2 G T 18: 80,174,036 (GRCm39) F124L probably benign Het
Aicda A G 6: 122,536,449 (GRCm39) K10E probably benign Het
Als2 A G 1: 59,226,575 (GRCm39) C910R probably benign Het
Ankrd11 T A 8: 123,619,156 (GRCm39) K1565N probably damaging Het
Apol7b T C 15: 77,308,909 (GRCm39) D63G probably damaging Het
Arhgef4 T C 1: 34,764,187 (GRCm39) C1148R possibly damaging Het
Atg16l1 A G 1: 87,694,629 (GRCm39) D102G probably damaging Het
Babam2 T C 5: 32,158,782 (GRCm39) V244A probably damaging Het
Brd10 T G 19: 29,720,990 (GRCm39) K622N probably damaging Het
Cars1 G A 7: 143,113,411 (GRCm39) A668V possibly damaging Het
Ccdc168 T C 1: 44,100,129 (GRCm39) D323G possibly damaging Het
Ccdc185 T A 1: 182,576,453 (GRCm39) S79C possibly damaging Het
Ccdc88b G C 19: 6,826,359 (GRCm39) R1119G probably damaging Het
Cebpz A T 17: 79,231,896 (GRCm39) V810E probably damaging Het
Cep120 T C 18: 53,871,654 (GRCm39) T73A probably damaging Het
Chat C A 14: 32,145,269 (GRCm39) C380F possibly damaging Het
Cltc T C 11: 86,648,087 (GRCm39) Q10R probably benign Het
Cripto C T 9: 110,769,781 (GRCm39) M169I probably benign Het
Cst8 T C 2: 148,646,622 (GRCm39) probably benign Het
Cts3 C T 13: 61,715,868 (GRCm39) probably null Het
Cyp4a29 T A 4: 115,105,707 (GRCm39) D136E probably benign Het
Dmxl2 A C 9: 54,286,297 (GRCm39) probably null Het
Dsg4 T A 18: 20,584,919 (GRCm39) V211E possibly damaging Het
Efcab5 C T 11: 77,008,656 (GRCm39) V957I probably damaging Het
Eif4g2 A T 7: 110,673,358 (GRCm39) L807Q possibly damaging Het
Epha4 A G 1: 77,366,731 (GRCm39) probably benign Het
Epm2aip1 A T 9: 111,101,458 (GRCm39) I144F probably benign Het
Erbb4 C T 1: 68,599,735 (GRCm39) R114H probably damaging Het
Fabp3 C T 4: 130,206,180 (GRCm39) T57I probably benign Het
Fam170a C T 18: 50,415,038 (GRCm39) A228V probably damaging Het
Foxred1 A T 9: 35,117,571 (GRCm39) M254K possibly damaging Het
Gm1527 T A 3: 28,952,969 (GRCm39) C90S probably benign Het
Gpr137b T C 13: 13,533,947 (GRCm39) T370A probably benign Het
Gtf2e2 A G 8: 34,245,993 (GRCm39) probably benign Het
Hgsnat A T 8: 26,445,817 (GRCm39) L359* probably null Het
Hhip A T 8: 80,719,223 (GRCm39) C435S probably damaging Het
Hoxa13 T C 6: 52,236,107 (GRCm39) D310G possibly damaging Het
Hspa14 T C 2: 3,513,675 (GRCm39) Y18C probably damaging Het
Ighg1 A G 12: 113,293,270 (GRCm39) V140A probably damaging Het
Ighv1-58 A T 12: 115,275,930 (GRCm39) Y69* probably null Het
Inpp5j A G 11: 3,450,185 (GRCm39) F615L probably benign Het
Kcna1 T A 6: 126,619,873 (GRCm39) Y149F probably benign Het
Kcnj6 A T 16: 94,625,877 (GRCm39) probably null Het
Krtap4-1 G T 11: 99,518,637 (GRCm39) C124* probably null Het
Lama1 T A 17: 68,119,368 (GRCm39) L2615* probably null Het
Lcp2 A T 11: 34,018,439 (GRCm39) I72F probably damaging Het
Med1 T A 11: 98,062,532 (GRCm39) I189F possibly damaging Het
Meioc C T 11: 102,566,654 (GRCm39) R757C probably damaging Het
Mtr T A 13: 12,204,283 (GRCm39) H1171L probably damaging Het
Mtr G C 13: 12,204,284 (GRCm39) H1171D probably damaging Het
Naa12 A G 18: 80,255,339 (GRCm39) D211G probably benign Het
Nlrc5 A G 8: 95,202,620 (GRCm39) Y240C possibly damaging Het
Nsun4 T A 4: 115,908,259 (GRCm39) H767L possibly damaging Het
Pcdha1 T A 18: 37,064,189 (GRCm39) N284K probably benign Het
Pcdhgb8 A C 18: 37,896,414 (GRCm39) S495R probably benign Het
Pramel1 T A 4: 143,123,260 (GRCm39) I79N possibly damaging Het
Prdm6 A T 18: 53,673,390 (GRCm39) E183D possibly damaging Het
Prex2 T C 1: 11,254,740 (GRCm39) F1125L probably benign Het
Prkg2 T C 5: 99,127,674 (GRCm39) I346V possibly damaging Het
Ptprz1 A G 6: 23,002,584 (GRCm39) D1558G probably damaging Het
Pttg1ip2 A C 5: 5,528,955 (GRCm39) L20R probably damaging Het
Qng1 T A 13: 58,529,800 (GRCm39) K271* probably null Het
Rab11fip3 GCTCGTCT GCT 17: 26,287,002 (GRCm39) probably null Het
Rin2 C T 2: 145,702,366 (GRCm39) T354I probably benign Het
S100a6 A G 3: 90,521,508 (GRCm39) D50G probably damaging Het
Sipa1l1 G A 12: 82,388,556 (GRCm39) V261M possibly damaging Het
Slc5a4b T A 10: 75,910,826 (GRCm39) I337F probably damaging Het
Smarcc1 A G 9: 109,961,273 (GRCm39) Y30C possibly damaging Het
Swap70 A G 7: 109,880,512 (GRCm39) K576E possibly damaging Het
Syt6 A G 3: 103,532,809 (GRCm39) probably benign Het
Szt2 T C 4: 118,241,097 (GRCm39) I1726V probably benign Het
Thoc1 A G 18: 9,987,651 (GRCm39) K453E possibly damaging Het
Tmem38b A G 4: 53,854,409 (GRCm39) I214V probably benign Het
Tonsl A T 15: 76,521,244 (GRCm39) I354N probably damaging Het
Trappc9 T C 15: 72,903,472 (GRCm39) I303V possibly damaging Het
Trim66 A G 7: 109,057,338 (GRCm39) S1032P probably damaging Het
Tsc22d4 T C 5: 137,756,590 (GRCm39) V6A probably benign Het
Ubtd2 A G 11: 32,449,260 (GRCm39) K36E probably benign Het
Zkscan2 T C 7: 123,097,883 (GRCm39) E171G possibly damaging Het
Other mutations in Shroom3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00850:Shroom3 APN 5 93,098,924 (GRCm39) missense probably damaging 1.00
IGL01086:Shroom3 APN 5 93,096,311 (GRCm39) missense probably benign 0.01
IGL01363:Shroom3 APN 5 93,088,852 (GRCm39) missense probably benign 0.01
IGL01468:Shroom3 APN 5 93,088,201 (GRCm39) missense probably damaging 1.00
IGL01675:Shroom3 APN 5 93,089,539 (GRCm39) missense probably damaging 0.99
IGL01862:Shroom3 APN 5 93,110,148 (GRCm39) missense probably damaging 1.00
IGL01987:Shroom3 APN 5 93,090,048 (GRCm39) missense probably damaging 0.99
IGL02104:Shroom3 APN 5 93,088,248 (GRCm39) missense probably benign 0.32
IGL03248:Shroom3 APN 5 93,100,399 (GRCm39) missense probably benign 0.00
IGL03386:Shroom3 APN 5 93,096,342 (GRCm39) splice site probably benign
R0167:Shroom3 UTSW 5 93,096,254 (GRCm39) splice site probably benign
R0388:Shroom3 UTSW 5 93,099,152 (GRCm39) missense probably benign 0.39
R0395:Shroom3 UTSW 5 92,928,762 (GRCm39) missense probably damaging 1.00
R0567:Shroom3 UTSW 5 93,112,312 (GRCm39) missense possibly damaging 0.53
R1496:Shroom3 UTSW 5 93,090,693 (GRCm39) missense possibly damaging 0.69
R1772:Shroom3 UTSW 5 93,088,515 (GRCm39) missense probably damaging 0.97
R1845:Shroom3 UTSW 5 93,090,945 (GRCm39) missense probably damaging 1.00
R1921:Shroom3 UTSW 5 93,110,224 (GRCm39) critical splice donor site probably null
R2059:Shroom3 UTSW 5 92,831,643 (GRCm39) missense probably damaging 1.00
R2203:Shroom3 UTSW 5 93,090,945 (GRCm39) missense probably damaging 1.00
R2204:Shroom3 UTSW 5 93,090,945 (GRCm39) missense probably damaging 1.00
R2205:Shroom3 UTSW 5 93,090,945 (GRCm39) missense probably damaging 1.00
R2301:Shroom3 UTSW 5 93,090,945 (GRCm39) missense probably damaging 1.00
R2344:Shroom3 UTSW 5 93,090,945 (GRCm39) missense probably damaging 1.00
R2345:Shroom3 UTSW 5 93,090,945 (GRCm39) missense probably damaging 1.00
R2346:Shroom3 UTSW 5 93,090,945 (GRCm39) missense probably damaging 1.00
R2348:Shroom3 UTSW 5 93,090,945 (GRCm39) missense probably damaging 1.00
R2371:Shroom3 UTSW 5 92,928,729 (GRCm39) missense probably damaging 1.00
R2435:Shroom3 UTSW 5 93,090,945 (GRCm39) missense probably damaging 1.00
R2829:Shroom3 UTSW 5 93,090,945 (GRCm39) missense probably damaging 1.00
R2830:Shroom3 UTSW 5 93,090,945 (GRCm39) missense probably damaging 1.00
R2831:Shroom3 UTSW 5 93,090,945 (GRCm39) missense probably damaging 1.00
R2897:Shroom3 UTSW 5 93,090,945 (GRCm39) missense probably damaging 1.00
R2898:Shroom3 UTSW 5 93,090,945 (GRCm39) missense probably damaging 1.00
R3079:Shroom3 UTSW 5 93,090,945 (GRCm39) missense probably damaging 1.00
R3080:Shroom3 UTSW 5 93,090,945 (GRCm39) missense probably damaging 1.00
R3433:Shroom3 UTSW 5 93,090,945 (GRCm39) missense probably damaging 1.00
R3729:Shroom3 UTSW 5 93,090,945 (GRCm39) missense probably damaging 1.00
R3730:Shroom3 UTSW 5 93,090,945 (GRCm39) missense probably damaging 1.00
R3735:Shroom3 UTSW 5 93,112,303 (GRCm39) missense possibly damaging 0.84
R3736:Shroom3 UTSW 5 93,112,303 (GRCm39) missense possibly damaging 0.84
R3851:Shroom3 UTSW 5 93,090,945 (GRCm39) missense probably damaging 1.00
R3852:Shroom3 UTSW 5 93,090,945 (GRCm39) missense probably damaging 1.00
R3943:Shroom3 UTSW 5 93,090,945 (GRCm39) missense probably damaging 1.00
R3969:Shroom3 UTSW 5 93,088,738 (GRCm39) missense probably benign 0.05
R4008:Shroom3 UTSW 5 93,090,945 (GRCm39) missense probably damaging 1.00
R4009:Shroom3 UTSW 5 93,090,945 (GRCm39) missense probably damaging 1.00
R4154:Shroom3 UTSW 5 93,090,945 (GRCm39) missense probably damaging 1.00
R4157:Shroom3 UTSW 5 93,090,945 (GRCm39) missense probably damaging 1.00
R4172:Shroom3 UTSW 5 93,090,945 (GRCm39) missense probably damaging 1.00
R4173:Shroom3 UTSW 5 93,090,945 (GRCm39) missense probably damaging 1.00
R4201:Shroom3 UTSW 5 93,090,945 (GRCm39) missense probably damaging 1.00
R4202:Shroom3 UTSW 5 93,090,945 (GRCm39) missense probably damaging 1.00
R4204:Shroom3 UTSW 5 93,090,945 (GRCm39) missense probably damaging 1.00
R4205:Shroom3 UTSW 5 93,090,945 (GRCm39) missense probably damaging 1.00
R4206:Shroom3 UTSW 5 93,090,945 (GRCm39) missense probably damaging 1.00
R4284:Shroom3 UTSW 5 93,090,945 (GRCm39) missense probably damaging 1.00
R4285:Shroom3 UTSW 5 93,090,945 (GRCm39) missense probably damaging 1.00
R4364:Shroom3 UTSW 5 93,090,945 (GRCm39) missense probably damaging 1.00
R4384:Shroom3 UTSW 5 93,090,945 (GRCm39) missense probably damaging 1.00
R4456:Shroom3 UTSW 5 93,088,858 (GRCm39) missense probably benign 0.14
R4707:Shroom3 UTSW 5 93,090,945 (GRCm39) missense probably damaging 1.00
R4712:Shroom3 UTSW 5 93,090,945 (GRCm39) missense probably damaging 1.00
R4751:Shroom3 UTSW 5 93,090,945 (GRCm39) missense probably damaging 1.00
R4755:Shroom3 UTSW 5 93,090,945 (GRCm39) missense probably damaging 1.00
R4760:Shroom3 UTSW 5 93,090,945 (GRCm39) missense probably damaging 1.00
R4773:Shroom3 UTSW 5 93,090,945 (GRCm39) missense probably damaging 1.00
R4774:Shroom3 UTSW 5 93,090,945 (GRCm39) missense probably damaging 1.00
R4776:Shroom3 UTSW 5 93,090,945 (GRCm39) missense probably damaging 1.00
R4801:Shroom3 UTSW 5 93,090,945 (GRCm39) missense probably damaging 1.00
R4802:Shroom3 UTSW 5 93,090,945 (GRCm39) missense probably damaging 1.00
R4856:Shroom3 UTSW 5 93,090,945 (GRCm39) missense probably damaging 1.00
R4857:Shroom3 UTSW 5 93,090,945 (GRCm39) missense probably damaging 1.00
R4860:Shroom3 UTSW 5 93,090,945 (GRCm39) missense probably damaging 1.00
R4860:Shroom3 UTSW 5 93,090,945 (GRCm39) missense probably damaging 1.00
R4882:Shroom3 UTSW 5 93,090,945 (GRCm39) missense probably damaging 1.00
R4883:Shroom3 UTSW 5 93,098,993 (GRCm39) missense probably benign 0.14
R4886:Shroom3 UTSW 5 93,090,945 (GRCm39) missense probably damaging 1.00
R5262:Shroom3 UTSW 5 93,112,432 (GRCm39) missense probably damaging 1.00
R5271:Shroom3 UTSW 5 93,110,107 (GRCm39) missense probably damaging 1.00
R5719:Shroom3 UTSW 5 93,090,877 (GRCm39) missense probably benign 0.04
R5726:Shroom3 UTSW 5 93,090,864 (GRCm39) missense probably benign 0.00
R5993:Shroom3 UTSW 5 93,088,047 (GRCm39) missense probably damaging 1.00
R6078:Shroom3 UTSW 5 93,090,945 (GRCm39) missense probably damaging 1.00
R6079:Shroom3 UTSW 5 93,090,945 (GRCm39) missense probably damaging 1.00
R6138:Shroom3 UTSW 5 93,090,945 (GRCm39) missense probably damaging 1.00
R6153:Shroom3 UTSW 5 93,112,267 (GRCm39) missense probably damaging 0.99
R6493:Shroom3 UTSW 5 93,089,420 (GRCm39) missense probably benign 0.03
R6495:Shroom3 UTSW 5 93,089,928 (GRCm39) missense possibly damaging 0.66
R6693:Shroom3 UTSW 5 93,088,617 (GRCm39) missense possibly damaging 0.61
R6801:Shroom3 UTSW 5 93,088,795 (GRCm39) missense probably damaging 1.00
R6893:Shroom3 UTSW 5 93,090,063 (GRCm39) missense probably damaging 0.97
R6912:Shroom3 UTSW 5 93,090,876 (GRCm39) missense probably benign 0.02
R6924:Shroom3 UTSW 5 93,112,262 (GRCm39) missense probably damaging 1.00
R7083:Shroom3 UTSW 5 93,112,384 (GRCm39) missense probably damaging 1.00
R7197:Shroom3 UTSW 5 93,090,463 (GRCm39) missense probably damaging 1.00
R7366:Shroom3 UTSW 5 93,112,465 (GRCm39) nonsense probably null
R7712:Shroom3 UTSW 5 93,098,806 (GRCm39) missense probably benign 0.01
R7725:Shroom3 UTSW 5 93,089,512 (GRCm39) missense probably benign 0.19
R7728:Shroom3 UTSW 5 92,831,566 (GRCm39) missense possibly damaging 0.73
R7774:Shroom3 UTSW 5 93,098,348 (GRCm39) missense probably damaging 0.98
R7795:Shroom3 UTSW 5 93,067,508 (GRCm39) missense probably damaging 0.99
R7821:Shroom3 UTSW 5 93,088,705 (GRCm39) missense probably damaging 0.98
R7971:Shroom3 UTSW 5 93,098,933 (GRCm39) missense probably damaging 1.00
R8276:Shroom3 UTSW 5 93,088,339 (GRCm39) missense probably damaging 0.99
R8934:Shroom3 UTSW 5 93,089,584 (GRCm39) missense probably damaging 1.00
R8938:Shroom3 UTSW 5 93,090,930 (GRCm39) missense probably damaging 1.00
R9083:Shroom3 UTSW 5 93,098,533 (GRCm39) missense probably damaging 0.97
R9108:Shroom3 UTSW 5 93,087,975 (GRCm39) missense probably damaging 1.00
R9124:Shroom3 UTSW 5 93,112,401 (GRCm39) missense probably benign 0.19
R9295:Shroom3 UTSW 5 93,098,478 (GRCm39) missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GTTACTGACACCACGTGAAGGC -3'
(R):5'- TAGTGTACAGAAAGGCGCTG -3'

Sequencing Primer
(F):5'- CGAGCCTTGGGAGAGTTTAC -3'
(R):5'- ATAGTCATTCCCTGATGGAGACCTG -3'
Posted On 2015-04-29