Incidental Mutation 'R4012:Foxred1'
ID311755
Institutional Source Beutler Lab
Gene Symbol Foxred1
Ensembl Gene ENSMUSG00000039048
Gene NameFAD-dependent oxidoreductase domain containing 1
SynonymsTex23, TEG-23
MMRRC Submission 040949-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4012 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location35204206-35211055 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 35206275 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Lysine at position 254 (M254K)
Ref Sequence ENSEMBL: ENSMUSP00000118037 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034541] [ENSMUST00000043805] [ENSMUST00000127996] [ENSMUST00000135054] [ENSMUST00000138287] [ENSMUST00000138692] [ENSMUST00000139703] [ENSMUST00000142595] [ENSMUST00000151658] [ENSMUST00000154691]
Predicted Effect probably benign
Transcript: ENSMUST00000034541
SMART Domains Protein: ENSMUSP00000034541
Gene: ENSMUSG00000032042

DomainStartEndE-ValueType
Pfam:SRP-alpha_N 27 301 4.4e-69 PFAM
SRP54_N 318 395 4.04e-6 SMART
AAA 415 568 9.65e-10 SMART
SRP54 416 635 3.47e-78 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000043805
AA Change: M254K

PolyPhen 2 Score 0.479 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000038924
Gene: ENSMUSG00000039048
AA Change: M254K

DomainStartEndE-ValueType
low complexity region 3 20 N/A INTRINSIC
Pfam:DAO 65 462 2.8e-50 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000127996
AA Change: M254K

PolyPhen 2 Score 0.479 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000118037
Gene: ENSMUSG00000039048
AA Change: M254K

DomainStartEndE-ValueType
low complexity region 3 20 N/A INTRINSIC
Pfam:DAO 65 456 1.8e-62 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130072
Predicted Effect probably benign
Transcript: ENSMUST00000135054
SMART Domains Protein: ENSMUSP00000115301
Gene: ENSMUSG00000039048

DomainStartEndE-ValueType
Pfam:DAO 3 140 1.1e-10 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000138287
Predicted Effect probably benign
Transcript: ENSMUST00000138692
SMART Domains Protein: ENSMUSP00000120556
Gene: ENSMUSG00000039048

DomainStartEndE-ValueType
low complexity region 3 20 N/A INTRINSIC
low complexity region 29 43 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000139703
SMART Domains Protein: ENSMUSP00000122535
Gene: ENSMUSG00000039048

DomainStartEndE-ValueType
low complexity region 3 20 N/A INTRINSIC
Pfam:DAO 65 184 1.6e-15 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140177
Predicted Effect probably benign
Transcript: ENSMUST00000142595
AA Change: N188K

PolyPhen 2 Score 0.026 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000117147
Gene: ENSMUSG00000039048
AA Change: N188K

DomainStartEndE-ValueType
low complexity region 3 20 N/A INTRINSIC
Pfam:DAO 65 187 3.4e-15 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143039
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151082
Predicted Effect probably benign
Transcript: ENSMUST00000151658
SMART Domains Protein: ENSMUSP00000120284
Gene: ENSMUSG00000039048

DomainStartEndE-ValueType
low complexity region 3 20 N/A INTRINSIC
Pfam:DAO 65 121 5.8e-9 PFAM
low complexity region 128 138 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000154691
SMART Domains Protein: ENSMUSP00000123496
Gene: ENSMUSG00000039048

DomainStartEndE-ValueType
low complexity region 3 20 N/A INTRINSIC
low complexity region 29 43 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000216618
Meta Mutation Damage Score 0.1485 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 93.0%
Validation Efficiency 100% (79/79)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that contains a FAD-dependent oxidoreductase domain. The encoded protein is localized to the mitochondria and may function as a chaperone protein required for the function of mitochondrial complex I. Mutations in this gene are associated with mitochondrial complex I deficiency. Alternatively spliced transcript variants have been observed for this gene. [provided by RefSeq, Dec 2010]
Allele List at MGI
Other mutations in this stock
Total: 79 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700015F17Rik A C 5: 5,478,955 L20R probably damaging Het
2210016F16Rik T A 13: 58,381,986 K271* probably null Het
9930021J03Rik T G 19: 29,743,590 K622N probably damaging Het
Adnp2 G T 18: 80,130,821 F124L probably benign Het
Aicda A G 6: 122,559,490 K10E probably benign Het
Als2 A G 1: 59,187,416 C910R probably benign Het
Ankrd11 T A 8: 122,892,417 K1565N probably damaging Het
Apol7b T C 15: 77,424,709 D63G probably damaging Het
Arhgef4 T C 1: 34,725,106 C1148R possibly damaging Het
Atg16l1 A G 1: 87,766,907 D102G probably damaging Het
Babam2 T C 5: 32,001,438 V244A probably damaging Het
Cars G A 7: 143,559,674 A668V possibly damaging Het
Ccdc185 T A 1: 182,748,888 S79C possibly damaging Het
Ccdc88b G C 19: 6,848,991 R1119G probably damaging Het
Cebpz A T 17: 78,924,467 V810E probably damaging Het
Cep120 T C 18: 53,738,582 T73A probably damaging Het
Chat C A 14: 32,423,312 C380F possibly damaging Het
Cltc T C 11: 86,757,261 Q10R probably benign Het
Cst8 T C 2: 148,804,702 probably benign Het
Cts3 C T 13: 61,568,054 probably null Het
Cyp4a29 T A 4: 115,248,510 D136E probably benign Het
Dmxl2 A C 9: 54,379,013 probably null Het
Dsg4 T A 18: 20,451,862 V211E possibly damaging Het
Efcab5 C T 11: 77,117,830 V957I probably damaging Het
Eif4g2 A T 7: 111,074,151 L807Q possibly damaging Het
Epha4 A G 1: 77,390,094 probably benign Het
Epm2aip1 A T 9: 111,272,390 I144F probably benign Het
Erbb4 C T 1: 68,560,576 R114H probably damaging Het
Fabp3 C T 4: 130,312,387 T57I probably benign Het
Fam170a C T 18: 50,281,971 A228V probably damaging Het
Gm1527 T A 3: 28,898,820 C90S probably benign Het
Gm16286 A G 18: 80,212,124 D211G probably benign Het
Gm8251 T C 1: 44,060,969 D323G possibly damaging Het
Gpr137b T C 13: 13,359,362 T370A probably benign Het
Gtf2e2 A G 8: 33,755,965 probably benign Het
Hgsnat A T 8: 25,955,789 L359* probably null Het
Hhip A T 8: 79,992,594 C435S probably damaging Het
Hoxa13 T C 6: 52,259,127 D310G possibly damaging Het
Hspa14 T C 2: 3,512,638 Y18C probably damaging Het
Ighg1 A G 12: 113,329,650 V140A probably damaging Het
Ighv1-58 A T 12: 115,312,310 Y69* probably null Het
Inpp5j A G 11: 3,500,185 F615L probably benign Het
Kcna1 T A 6: 126,642,910 Y149F probably benign Het
Kcnj6 A T 16: 94,825,018 probably null Het
Krtap4-1 G T 11: 99,627,811 C124* probably null Het
Lama1 T A 17: 67,812,373 L2615* probably null Het
Lcp2 A T 11: 34,068,439 I72F probably damaging Het
Med1 T A 11: 98,171,706 I189F possibly damaging Het
Meioc C T 11: 102,675,828 R757C probably damaging Het
Mtr T A 13: 12,189,397 H1171L probably damaging Het
Mtr G C 13: 12,189,398 H1171D probably damaging Het
Nlrc5 A G 8: 94,475,992 Y240C possibly damaging Het
Nsun4 T A 4: 116,051,062 H767L possibly damaging Het
Pcdha1 T A 18: 36,931,136 N284K probably benign Het
Pcdhgb8 A C 18: 37,763,361 S495R probably benign Het
Pramel1 T A 4: 143,396,690 I79N possibly damaging Het
Prdm6 A T 18: 53,540,318 E183D possibly damaging Het
Prex2 T C 1: 11,184,516 F1125L probably benign Het
Prkg2 T C 5: 98,979,815 I346V possibly damaging Het
Ptprz1 A G 6: 23,002,585 D1558G probably damaging Het
Rab11fip3 GCTCGTCT GCT 17: 26,068,028 probably null Het
Rin2 C T 2: 145,860,446 T354I probably benign Het
S100a6 A G 3: 90,614,201 D50G probably damaging Het
Shroom3 T A 5: 92,948,483 probably benign Het
Sipa1l1 G A 12: 82,341,782 V261M possibly damaging Het
Slc5a4b T A 10: 76,074,992 I337F probably damaging Het
Smarcc1 A G 9: 110,132,205 Y30C possibly damaging Het
Swap70 A G 7: 110,281,305 K576E possibly damaging Het
Syt6 A G 3: 103,625,493 probably benign Het
Szt2 T C 4: 118,383,900 I1726V probably benign Het
Tdgf1 C T 9: 110,940,713 M169I probably benign Het
Thoc1 A G 18: 9,987,651 K453E possibly damaging Het
Tmem38b A G 4: 53,854,409 I214V probably benign Het
Tonsl A T 15: 76,637,044 I354N probably damaging Het
Trappc9 T C 15: 73,031,623 I303V possibly damaging Het
Trim66 A G 7: 109,458,131 S1032P probably damaging Het
Tsc22d4 T C 5: 137,758,328 V6A probably benign Het
Ubtd2 A G 11: 32,499,260 K36E probably benign Het
Zkscan2 T C 7: 123,498,660 E171G possibly damaging Het
Other mutations in Foxred1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02163:Foxred1 APN 9 35205896 missense probably damaging 1.00
IGL02314:Foxred1 APN 9 35205968 missense probably damaging 1.00
IGL02379:Foxred1 APN 9 35209986 missense probably benign 0.44
IGL02558:Foxred1 APN 9 35210133 missense probably damaging 1.00
PIT4494001:Foxred1 UTSW 9 35209059 missense possibly damaging 0.95
R0220:Foxred1 UTSW 9 35209453 missense probably damaging 1.00
R0605:Foxred1 UTSW 9 35204882 missense possibly damaging 0.68
R0763:Foxred1 UTSW 9 35207473 splice site probably null
R1136:Foxred1 UTSW 9 35205037 missense probably benign 0.25
R1449:Foxred1 UTSW 9 35209442 missense probably damaging 1.00
R1757:Foxred1 UTSW 9 35210834 missense probably benign 0.16
R2157:Foxred1 UTSW 9 35205363 missense probably damaging 1.00
R2434:Foxred1 UTSW 9 35205658 missense probably damaging 0.99
R3713:Foxred1 UTSW 9 35210890 start codon destroyed probably null
R4666:Foxred1 UTSW 9 35210855 intron probably benign
R4934:Foxred1 UTSW 9 35209914 intron probably benign
R5488:Foxred1 UTSW 9 35209970 missense probably damaging 1.00
R5489:Foxred1 UTSW 9 35209970 missense probably damaging 1.00
R5828:Foxred1 UTSW 9 35210196 intron probably benign
R5840:Foxred1 UTSW 9 35210139 missense probably damaging 0.99
R7037:Foxred1 UTSW 9 35207548 missense probably benign 0.04
R7599:Foxred1 UTSW 9 35205636 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCACACAATGGATCCTGACATG -3'
(R):5'- ACAGACACAGGGAGAGTCTC -3'

Sequencing Primer
(F):5'- AATGGATCCTGACATGTTTATTTCCC -3'
(R):5'- GAGGAAGTCCAGCTCACTCATAG -3'
Posted On2015-04-29