Incidental Mutation 'R4012:Sipa1l1'
ID311770
Institutional Source Beutler Lab
Gene Symbol Sipa1l1
Ensembl Gene ENSMUSG00000042700
Gene Namesignal-induced proliferation-associated 1 like 1
Synonyms4931426N11Rik, Spar
MMRRC Submission 040949-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4012 (G1)
Quality Score225
Status Validated
Chromosome12
Chromosomal Location82169320-82451786 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 82341782 bp
ZygosityHeterozygous
Amino Acid Change Valine to Methionine at position 261 (V261M)
Ref Sequence ENSEMBL: ENSMUSP00000152681 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000053969] [ENSMUST00000166429] [ENSMUST00000220963] [ENSMUST00000222298] [ENSMUST00000222714]
Predicted Effect possibly damaging
Transcript: ENSMUST00000053969
AA Change: V261M

PolyPhen 2 Score 0.861 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000061014
Gene: ENSMUSG00000042700
AA Change: V261M

DomainStartEndE-ValueType
low complexity region 92 129 N/A INTRINSIC
low complexity region 362 377 N/A INTRINSIC
low complexity region 430 449 N/A INTRINSIC
Pfam:Rap_GAP 628 810 8.9e-70 PFAM
PDZ 962 1028 2.63e-9 SMART
low complexity region 1149 1164 N/A INTRINSIC
low complexity region 1255 1279 N/A INTRINSIC
low complexity region 1315 1328 N/A INTRINSIC
low complexity region 1432 1447 N/A INTRINSIC
Pfam:SPAR_C 1483 1727 4.4e-86 PFAM
low complexity region 1731 1746 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000166429
AA Change: V261M

PolyPhen 2 Score 0.861 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000131030
Gene: ENSMUSG00000042700
AA Change: V261M

DomainStartEndE-ValueType
low complexity region 92 129 N/A INTRINSIC
low complexity region 362 377 N/A INTRINSIC
low complexity region 430 449 N/A INTRINSIC
Pfam:Rap_GAP 628 816 1.3e-64 PFAM
PDZ 962 1028 1.3e-11 SMART
low complexity region 1149 1164 N/A INTRINSIC
low complexity region 1255 1279 N/A INTRINSIC
low complexity region 1315 1328 N/A INTRINSIC
low complexity region 1432 1447 N/A INTRINSIC
Pfam:DUF3401 1483 1727 1.8e-91 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000220766
Predicted Effect possibly damaging
Transcript: ENSMUST00000220963
AA Change: V261M

PolyPhen 2 Score 0.862 (Sensitivity: 0.83; Specificity: 0.93)
Predicted Effect possibly damaging
Transcript: ENSMUST00000222298
AA Change: V261M

PolyPhen 2 Score 0.861 (Sensitivity: 0.83; Specificity: 0.93)
Predicted Effect possibly damaging
Transcript: ENSMUST00000222714
AA Change: V261M

PolyPhen 2 Score 0.861 (Sensitivity: 0.83; Specificity: 0.93)
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 93.0%
Validation Efficiency 100% (79/79)
Allele List at MGI
Other mutations in this stock
Total: 79 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700015F17Rik A C 5: 5,478,955 L20R probably damaging Het
2210016F16Rik T A 13: 58,381,986 K271* probably null Het
9930021J03Rik T G 19: 29,743,590 K622N probably damaging Het
Adnp2 G T 18: 80,130,821 F124L probably benign Het
Aicda A G 6: 122,559,490 K10E probably benign Het
Als2 A G 1: 59,187,416 C910R probably benign Het
Ankrd11 T A 8: 122,892,417 K1565N probably damaging Het
Apol7b T C 15: 77,424,709 D63G probably damaging Het
Arhgef4 T C 1: 34,725,106 C1148R possibly damaging Het
Atg16l1 A G 1: 87,766,907 D102G probably damaging Het
Babam2 T C 5: 32,001,438 V244A probably damaging Het
Cars G A 7: 143,559,674 A668V possibly damaging Het
Ccdc185 T A 1: 182,748,888 S79C possibly damaging Het
Ccdc88b G C 19: 6,848,991 R1119G probably damaging Het
Cebpz A T 17: 78,924,467 V810E probably damaging Het
Cep120 T C 18: 53,738,582 T73A probably damaging Het
Chat C A 14: 32,423,312 C380F possibly damaging Het
Cltc T C 11: 86,757,261 Q10R probably benign Het
Cst8 T C 2: 148,804,702 probably benign Het
Cts3 C T 13: 61,568,054 probably null Het
Cyp4a29 T A 4: 115,248,510 D136E probably benign Het
Dmxl2 A C 9: 54,379,013 probably null Het
Dsg4 T A 18: 20,451,862 V211E possibly damaging Het
Efcab5 C T 11: 77,117,830 V957I probably damaging Het
Eif4g2 A T 7: 111,074,151 L807Q possibly damaging Het
Epha4 A G 1: 77,390,094 probably benign Het
Epm2aip1 A T 9: 111,272,390 I144F probably benign Het
Erbb4 C T 1: 68,560,576 R114H probably damaging Het
Fabp3 C T 4: 130,312,387 T57I probably benign Het
Fam170a C T 18: 50,281,971 A228V probably damaging Het
Foxred1 A T 9: 35,206,275 M254K possibly damaging Het
Gm1527 T A 3: 28,898,820 C90S probably benign Het
Gm16286 A G 18: 80,212,124 D211G probably benign Het
Gm8251 T C 1: 44,060,969 D323G possibly damaging Het
Gpr137b T C 13: 13,359,362 T370A probably benign Het
Gtf2e2 A G 8: 33,755,965 probably benign Het
Hgsnat A T 8: 25,955,789 L359* probably null Het
Hhip A T 8: 79,992,594 C435S probably damaging Het
Hoxa13 T C 6: 52,259,127 D310G possibly damaging Het
Hspa14 T C 2: 3,512,638 Y18C probably damaging Het
Ighg1 A G 12: 113,329,650 V140A probably damaging Het
Ighv1-58 A T 12: 115,312,310 Y69* probably null Het
Inpp5j A G 11: 3,500,185 F615L probably benign Het
Kcna1 T A 6: 126,642,910 Y149F probably benign Het
Kcnj6 A T 16: 94,825,018 probably null Het
Krtap4-1 G T 11: 99,627,811 C124* probably null Het
Lama1 T A 17: 67,812,373 L2615* probably null Het
Lcp2 A T 11: 34,068,439 I72F probably damaging Het
Med1 T A 11: 98,171,706 I189F possibly damaging Het
Meioc C T 11: 102,675,828 R757C probably damaging Het
Mtr T A 13: 12,189,397 H1171L probably damaging Het
Mtr G C 13: 12,189,398 H1171D probably damaging Het
Nlrc5 A G 8: 94,475,992 Y240C possibly damaging Het
Nsun4 T A 4: 116,051,062 H767L possibly damaging Het
Pcdha1 T A 18: 36,931,136 N284K probably benign Het
Pcdhgb8 A C 18: 37,763,361 S495R probably benign Het
Pramel1 T A 4: 143,396,690 I79N possibly damaging Het
Prdm6 A T 18: 53,540,318 E183D possibly damaging Het
Prex2 T C 1: 11,184,516 F1125L probably benign Het
Prkg2 T C 5: 98,979,815 I346V possibly damaging Het
Ptprz1 A G 6: 23,002,585 D1558G probably damaging Het
Rab11fip3 GCTCGTCT GCT 17: 26,068,028 probably null Het
Rin2 C T 2: 145,860,446 T354I probably benign Het
S100a6 A G 3: 90,614,201 D50G probably damaging Het
Shroom3 T A 5: 92,948,483 probably benign Het
Slc5a4b T A 10: 76,074,992 I337F probably damaging Het
Smarcc1 A G 9: 110,132,205 Y30C possibly damaging Het
Swap70 A G 7: 110,281,305 K576E possibly damaging Het
Syt6 A G 3: 103,625,493 probably benign Het
Szt2 T C 4: 118,383,900 I1726V probably benign Het
Tdgf1 C T 9: 110,940,713 M169I probably benign Het
Thoc1 A G 18: 9,987,651 K453E possibly damaging Het
Tmem38b A G 4: 53,854,409 I214V probably benign Het
Tonsl A T 15: 76,637,044 I354N probably damaging Het
Trappc9 T C 15: 73,031,623 I303V possibly damaging Het
Trim66 A G 7: 109,458,131 S1032P probably damaging Het
Tsc22d4 T C 5: 137,758,328 V6A probably benign Het
Ubtd2 A G 11: 32,499,260 K36E probably benign Het
Zkscan2 T C 7: 123,498,660 E171G possibly damaging Het
Other mutations in Sipa1l1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01309:Sipa1l1 APN 12 82387696 missense probably benign 0.06
IGL01478:Sipa1l1 APN 12 82446898 missense probably benign 0.00
IGL01620:Sipa1l1 APN 12 82422489 missense probably damaging 0.97
IGL02496:Sipa1l1 APN 12 82425094 missense probably damaging 1.00
IGL02550:Sipa1l1 APN 12 82440949 nonsense probably null
IGL02689:Sipa1l1 APN 12 82440820 missense probably benign 0.01
IGL02706:Sipa1l1 APN 12 82397433 missense possibly damaging 0.95
IGL02995:Sipa1l1 APN 12 82357331 missense probably benign 0.39
IGL03104:Sipa1l1 APN 12 82342130 missense probably benign 0.05
IGL03295:Sipa1l1 APN 12 82432940 missense probably damaging 1.00
bullae UTSW 12 82342250 missense probably damaging 1.00
bullish UTSW 12 82422471 nonsense probably null
ebullient UTSW 12 82341672 missense probably benign 0.18
PIT4431001:Sipa1l1 UTSW 12 82396516 missense probably benign 0.34
R0140:Sipa1l1 UTSW 12 82396200 missense probably damaging 1.00
R0348:Sipa1l1 UTSW 12 82384756 critical splice donor site probably null
R0534:Sipa1l1 UTSW 12 82425280 missense possibly damaging 0.94
R0538:Sipa1l1 UTSW 12 82425099 missense probably benign 0.00
R0547:Sipa1l1 UTSW 12 82437736 missense probably benign
R0980:Sipa1l1 UTSW 12 82342220 missense possibly damaging 0.60
R1051:Sipa1l1 UTSW 12 82449345 missense possibly damaging 0.48
R1244:Sipa1l1 UTSW 12 82425416 missense probably benign 0.00
R1473:Sipa1l1 UTSW 12 82341111 missense probably damaging 1.00
R1508:Sipa1l1 UTSW 12 82440893 missense probably damaging 1.00
R1563:Sipa1l1 UTSW 12 82341161 missense probably benign 0.31
R1671:Sipa1l1 UTSW 12 82397461 missense probably damaging 1.00
R1935:Sipa1l1 UTSW 12 82372434 missense probably damaging 1.00
R1950:Sipa1l1 UTSW 12 82341459 missense probably damaging 0.98
R2191:Sipa1l1 UTSW 12 82396691 nonsense probably null
R2249:Sipa1l1 UTSW 12 82342116 missense probably benign
R2909:Sipa1l1 UTSW 12 82357331 missense probably benign 0.39
R4154:Sipa1l1 UTSW 12 82425214 missense possibly damaging 0.95
R4382:Sipa1l1 UTSW 12 82446822 missense possibly damaging 0.46
R4448:Sipa1l1 UTSW 12 82341750 missense probably benign 0.15
R4651:Sipa1l1 UTSW 12 82422471 nonsense probably null
R4652:Sipa1l1 UTSW 12 82422471 nonsense probably null
R4751:Sipa1l1 UTSW 12 82341194 missense probably benign
R4755:Sipa1l1 UTSW 12 82372386 missense possibly damaging 0.74
R4888:Sipa1l1 UTSW 12 82342333 missense probably damaging 0.96
R4912:Sipa1l1 UTSW 12 82396678 missense possibly damaging 0.89
R4937:Sipa1l1 UTSW 12 82341329 missense probably benign 0.01
R5068:Sipa1l1 UTSW 12 82437827 missense probably damaging 1.00
R5113:Sipa1l1 UTSW 12 82440908 missense probably benign 0.11
R5114:Sipa1l1 UTSW 12 82440908 missense probably benign 0.11
R5240:Sipa1l1 UTSW 12 82341588 missense possibly damaging 0.92
R6041:Sipa1l1 UTSW 12 82342250 missense probably damaging 1.00
R6048:Sipa1l1 UTSW 12 82440869 missense probably benign 0.03
R6170:Sipa1l1 UTSW 12 82341672 missense probably benign 0.18
R6185:Sipa1l1 UTSW 12 82425028 missense probably damaging 1.00
R6326:Sipa1l1 UTSW 12 82372468 missense probably damaging 1.00
R6842:Sipa1l1 UTSW 12 82420546 missense probably benign 0.00
R7008:Sipa1l1 UTSW 12 82363112 missense probably damaging 0.99
R7058:Sipa1l1 UTSW 12 82403122 missense probably benign 0.00
R7069:Sipa1l1 UTSW 12 82341406 missense probably damaging 0.99
R7122:Sipa1l1 UTSW 12 82422462 missense possibly damaging 0.79
R7310:Sipa1l1 UTSW 12 82372495 missense probably damaging 1.00
R7469:Sipa1l1 UTSW 12 82420664 critical splice donor site probably null
R7718:Sipa1l1 UTSW 12 82342497 missense probably damaging 1.00
R7787:Sipa1l1 UTSW 12 82449988 missense possibly damaging 0.81
R7844:Sipa1l1 UTSW 12 82397493 missense probably damaging 1.00
R7893:Sipa1l1 UTSW 12 82341568 missense probably benign 0.00
R7927:Sipa1l1 UTSW 12 82397493 missense probably damaging 1.00
R7976:Sipa1l1 UTSW 12 82341568 missense probably benign 0.00
R8043:Sipa1l1 UTSW 12 82449926 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CACAGGGAATATGGCAGCACATC -3'
(R):5'- ACATCATAGTGGGCAAAGCAC -3'

Sequencing Primer
(F):5'- GGGAATATGGCAGCACATCTTCAATC -3'
(R):5'- GTCCAGGGCCTCACAGAATCTTC -3'
Posted On2015-04-29