Mutagenetix > Incidental Mutations

Incidental Mutation 'R4012:Trappc9'

311780

Institutional Source

Beutler Lab

Gene Symbol

Trappc9

Ensembl Gene

ENSMUSG00000047921

Gene Name

trafficking protein particle complex 9

Synonyms

TRS130, Nibp, 2900005P22Rik, 4632408O18Rik, 1810044A24Rik

MMRRC Submission

040949-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R4012 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

72589620-73061204 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 73031623 bp

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Valine at position 303 (I303V)

Ref Sequence

ENSEMBL: ENSMUSP00000131997 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000023276] [ENSMUST00000089770] [ENSMUST00000168191] [ENSMUST00000170633] [ENSMUST00000228960]

Predicted Effect

possibly damaging
Transcript: ENSMUST00000023276
AA Change: I115V

PolyPhen 2 Score 0.951 (Sensitivity: 0.79; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000023276
Gene: ENSMUSG00000047921
AA Change: I115V

Domain	Start	End	E-Value	Type
Pfam:TRAPPC9-Trs120	2	920	3.6e-239	PFAM

Predicted Effect

possibly damaging
Transcript: ENSMUST00000089770
AA Change: I294V

PolyPhen 2 Score 0.897 (Sensitivity: 0.82; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000087202
Gene: ENSMUSG00000047921
AA Change: I294V

Domain	Start	End	E-Value	Type
Pfam:TRAPPC9-Trs120	182	350	4.1e-20	PFAM
Pfam:TRAPPC9-Trs120	434	664	2.2e-16	PFAM
low complexity region	993	1004	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000168191
AA Change: I294V

PolyPhen 2 Score 0.161 (Sensitivity: 0.92; Specificity: 0.87)

SMART Domains

Protein: ENSMUSP00000131295
Gene: ENSMUSG00000047921
AA Change: I294V

Domain	Start	End	E-Value	Type
Pfam:TRAPPC9-Trs120	1	810	3.7e-222	PFAM

Predicted Effect

possibly damaging
Transcript: ENSMUST00000170633
AA Change: I303V

PolyPhen 2 Score 0.952 (Sensitivity: 0.79; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000131997
Gene: ENSMUSG00000047921
AA Change: I303V

Domain	Start	End	E-Value	Type
Pfam:TRAPPC9-Trs120	1	820	7.6e-224	PFAM
coiled coil region	857	885	N/A	INTRINSIC
low complexity region	906	929	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000228960
AA Change: I294V

PolyPhen 2 Score 0.288 (Sensitivity: 0.91; Specificity: 0.88)

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000230025

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000230270

Meta Mutation Damage Score

0.1174

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 96.8%
20x: 93.0%

Validation Efficiency

100% (79/79)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that likely plays a role in NF-kappa-B signaling. Mutations in this gene have been associated with autosomal-recessive mental retardation. Alternatively spliced transcript variants have been described.[provided by RefSeq, Feb 2010]

Allele List at MGI

Other mutations in this stock

Total: 79 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700015F17Rik	A	C	5: 5,478,955	L20R	probably damaging	Het
2210016F16Rik	T	A	13: 58,381,986	K271*	probably null	Het
9930021J03Rik	T	G	19: 29,743,590	K622N	probably damaging	Het
Adnp2	G	T	18: 80,130,821	F124L	probably benign	Het
Aicda	A	G	6: 122,559,490	K10E	probably benign	Het
Als2	A	G	1: 59,187,416	C910R	probably benign	Het
Ankrd11	T	A	8: 122,892,417	K1565N	probably damaging	Het
Apol7b	T	C	15: 77,424,709	D63G	probably damaging	Het
Arhgef4	T	C	1: 34,725,106	C1148R	possibly damaging	Het
Atg16l1	A	G	1: 87,766,907	D102G	probably damaging	Het
Babam2	T	C	5: 32,001,438	V244A	probably damaging	Het
Cars	G	A	7: 143,559,674	A668V	possibly damaging	Het
Ccdc185	T	A	1: 182,748,888	S79C	possibly damaging	Het
Ccdc88b	G	C	19: 6,848,991	R1119G	probably damaging	Het
Cebpz	A	T	17: 78,924,467	V810E	probably damaging	Het
Cep120	T	C	18: 53,738,582	T73A	probably damaging	Het
Chat	C	A	14: 32,423,312	C380F	possibly damaging	Het
Cltc	T	C	11: 86,757,261	Q10R	probably benign	Het
Cst8	T	C	2: 148,804,702		probably benign	Het
Cts3	C	T	13: 61,568,054		probably null	Het
Cyp4a29	T	A	4: 115,248,510	D136E	probably benign	Het
Dmxl2	A	C	9: 54,379,013		probably null	Het
Dsg4	T	A	18: 20,451,862	V211E	possibly damaging	Het
Efcab5	C	T	11: 77,117,830	V957I	probably damaging	Het
Eif4g2	A	T	7: 111,074,151	L807Q	possibly damaging	Het
Epha4	A	G	1: 77,390,094		probably benign	Het
Epm2aip1	A	T	9: 111,272,390	I144F	probably benign	Het
Erbb4	C	T	1: 68,560,576	R114H	probably damaging	Het
Fabp3	C	T	4: 130,312,387	T57I	probably benign	Het
Fam170a	C	T	18: 50,281,971	A228V	probably damaging	Het
Foxred1	A	T	9: 35,206,275	M254K	possibly damaging	Het
Gm1527	T	A	3: 28,898,820	C90S	probably benign	Het
Gm16286	A	G	18: 80,212,124	D211G	probably benign	Het
Gm8251	T	C	1: 44,060,969	D323G	possibly damaging	Het
Gpr137b	T	C	13: 13,359,362	T370A	probably benign	Het
Gtf2e2	A	G	8: 33,755,965		probably benign	Het
Hgsnat	A	T	8: 25,955,789	L359*	probably null	Het
Hhip	A	T	8: 79,992,594	C435S	probably damaging	Het
Hoxa13	T	C	6: 52,259,127	D310G	possibly damaging	Het
Hspa14	T	C	2: 3,512,638	Y18C	probably damaging	Het
Ighg1	A	G	12: 113,329,650	V140A	probably damaging	Het
Ighv1-58	A	T	12: 115,312,310	Y69*	probably null	Het
Inpp5j	A	G	11: 3,500,185	F615L	probably benign	Het
Kcna1	T	A	6: 126,642,910	Y149F	probably benign	Het
Kcnj6	A	T	16: 94,825,018		probably null	Het
Krtap4-1	G	T	11: 99,627,811	C124*	probably null	Het
Lama1	T	A	17: 67,812,373	L2615*	probably null	Het
Lcp2	A	T	11: 34,068,439	I72F	probably damaging	Het
Med1	T	A	11: 98,171,706	I189F	possibly damaging	Het
Meioc	C	T	11: 102,675,828	R757C	probably damaging	Het
Mtr	T	A	13: 12,189,397	H1171L	probably damaging	Het
Mtr	G	C	13: 12,189,398	H1171D	probably damaging	Het
Nlrc5	A	G	8: 94,475,992	Y240C	possibly damaging	Het
Nsun4	T	A	4: 116,051,062	H767L	possibly damaging	Het
Pcdha1	T	A	18: 36,931,136	N284K	probably benign	Het
Pcdhgb8	A	C	18: 37,763,361	S495R	probably benign	Het
Pramel1	T	A	4: 143,396,690	I79N	possibly damaging	Het
Prdm6	A	T	18: 53,540,318	E183D	possibly damaging	Het
Prex2	T	C	1: 11,184,516	F1125L	probably benign	Het
Prkg2	T	C	5: 98,979,815	I346V	possibly damaging	Het
Ptprz1	A	G	6: 23,002,585	D1558G	probably damaging	Het
Rab11fip3	GCTCGTCT	GCT	17: 26,068,028		probably null	Het
Rin2	C	T	2: 145,860,446	T354I	probably benign	Het
S100a6	A	G	3: 90,614,201	D50G	probably damaging	Het
Shroom3	T	A	5: 92,948,483		probably benign	Het
Sipa1l1	G	A	12: 82,341,782	V261M	possibly damaging	Het
Slc5a4b	T	A	10: 76,074,992	I337F	probably damaging	Het
Smarcc1	A	G	9: 110,132,205	Y30C	possibly damaging	Het
Swap70	A	G	7: 110,281,305	K576E	possibly damaging	Het
Syt6	A	G	3: 103,625,493		probably benign	Het
Szt2	T	C	4: 118,383,900	I1726V	probably benign	Het
Tdgf1	C	T	9: 110,940,713	M169I	probably benign	Het
Thoc1	A	G	18: 9,987,651	K453E	possibly damaging	Het
Tmem38b	A	G	4: 53,854,409	I214V	probably benign	Het
Tonsl	A	T	15: 76,637,044	I354N	probably damaging	Het
Trim66	A	G	7: 109,458,131	S1032P	probably damaging	Het
Tsc22d4	T	C	5: 137,758,328	V6A	probably benign	Het
Ubtd2	A	G	11: 32,499,260	K36E	probably benign	Het
Zkscan2	T	C	7: 123,498,660	E171G	possibly damaging	Het

Other mutations in Trappc9

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00092:Trappc9	APN	15	73026026	missense	possibly damaging	0.79
IGL01348:Trappc9	APN	15	72937009	missense	possibly damaging	0.64
IGL01367:Trappc9	APN	15	72590153	missense	probably benign	0.31
IGL01521:Trappc9	APN	15	73052167	missense	probably damaging	1.00
IGL01726:Trappc9	APN	15	72946122	missense	probably damaging	0.98
IGL01881:Trappc9	APN	15	72999992	missense	probably damaging	1.00
IGL02214:Trappc9	APN	15	73012882	nonsense	probably null
IGL02693:Trappc9	APN	15	72963693	splice site	probably benign
IGL03229:Trappc9	APN	15	73058456	missense	probably damaging	1.00
basilio	UTSW	15	73058393	missense	probably damaging	1.00
Boomboom	UTSW	15	72736869	nonsense	probably null
Sotto_aceto	UTSW	15	72685339	missense	probably damaging	0.99
P0026:Trappc9	UTSW	15	72953082	missense	probably damaging	1.00
PIT4453001:Trappc9	UTSW	15	73031598	frame shift	probably null
PIT4519001:Trappc9	UTSW	15	72953094	missense	probably benign
R0001:Trappc9	UTSW	15	72963662	missense	probably damaging	1.00
R0094:Trappc9	UTSW	15	72894929	intron	probably benign
R0745:Trappc9	UTSW	15	73025967	missense	probably damaging	1.00
R0747:Trappc9	UTSW	15	73025967	missense	probably damaging	1.00
R0800:Trappc9	UTSW	15	72953132	splice site	probably benign
R0816:Trappc9	UTSW	15	73025967	missense	probably damaging	1.00
R0819:Trappc9	UTSW	15	73025967	missense	probably damaging	1.00
R0820:Trappc9	UTSW	15	73025967	missense	probably damaging	1.00
R0893:Trappc9	UTSW	15	72590107	missense	probably damaging	1.00
R0976:Trappc9	UTSW	15	72999974	missense	probably damaging	0.99
R1119:Trappc9	UTSW	15	73025967	missense	probably damaging	1.00
R1266:Trappc9	UTSW	15	73025967	missense	probably damaging	1.00
R1453:Trappc9	UTSW	15	73025967	missense	probably damaging	1.00
R1454:Trappc9	UTSW	15	73025967	missense	probably damaging	1.00
R1531:Trappc9	UTSW	15	72693548	nonsense	probably null
R1543:Trappc9	UTSW	15	73025967	missense	probably damaging	1.00
R1563:Trappc9	UTSW	15	73025967	missense	probably damaging	1.00
R1565:Trappc9	UTSW	15	73025967	missense	probably damaging	1.00
R1600:Trappc9	UTSW	15	72937109	nonsense	probably null
R1712:Trappc9	UTSW	15	73025967	missense	probably damaging	1.00
R1756:Trappc9	UTSW	15	73025967	missense	probably damaging	1.00
R1789:Trappc9	UTSW	15	73025967	missense	probably damaging	1.00
R1978:Trappc9	UTSW	15	73000025	missense	probably damaging	1.00
R2001:Trappc9	UTSW	15	73058036	missense	probably damaging	0.99
R2312:Trappc9	UTSW	15	73025967	missense	probably damaging	1.00
R2334:Trappc9	UTSW	15	73025967	missense	probably damaging	1.00
R2926:Trappc9	UTSW	15	73025967	missense	probably damaging	1.00
R3123:Trappc9	UTSW	15	73025967	missense	probably damaging	1.00
R3124:Trappc9	UTSW	15	73025967	missense	probably damaging	1.00
R3125:Trappc9	UTSW	15	73025967	missense	probably damaging	1.00
R3813:Trappc9	UTSW	15	73058393	missense	probably damaging	1.00
R4080:Trappc9	UTSW	15	72941947	missense	probably damaging	1.00
R4282:Trappc9	UTSW	15	72590792	missense	probably damaging	1.00
R4572:Trappc9	UTSW	15	72937067	missense	possibly damaging	0.61
R4739:Trappc9	UTSW	15	72937060	missense	probably damaging	0.97
R4959:Trappc9	UTSW	15	72937056	missense	probably damaging	1.00
R4973:Trappc9	UTSW	15	72937056	missense	probably damaging	1.00
R5123:Trappc9	UTSW	15	72913366	intron	probably benign
R5128:Trappc9	UTSW	15	73058393	missense	probably damaging	1.00
R5228:Trappc9	UTSW	15	73057995	missense	probably damaging	1.00
R5362:Trappc9	UTSW	15	73058217	missense	possibly damaging	0.68
R5802:Trappc9	UTSW	15	72685339	missense	probably damaging	0.99
R6032:Trappc9	UTSW	15	72925530	missense	probably benign	0.43
R6032:Trappc9	UTSW	15	72925530	missense	probably benign	0.43
R6154:Trappc9	UTSW	15	73058081	missense	probably benign	0.03
R6372:Trappc9	UTSW	15	72590074	missense	possibly damaging	0.75
R6661:Trappc9	UTSW	15	72590144	missense	possibly damaging	0.55
R6864:Trappc9	UTSW	15	72937162	intron	probably null
R6893:Trappc9	UTSW	15	72925650	missense	possibly damaging	0.93
R7099:Trappc9	UTSW	15	72693619	missense	probably benign	0.00
R7276:Trappc9	UTSW	15	73052270	missense	probably damaging	0.99
R7349:Trappc9	UTSW	15	72736869	nonsense	probably null
RF008:Trappc9	UTSW	15	72801289	small insertion	probably benign
RF009:Trappc9	UTSW	15	72801287	small insertion	probably benign
RF014:Trappc9	UTSW	15	72801283	small insertion	probably benign
RF016:Trappc9	UTSW	15	72801289	small insertion	probably benign
RF023:Trappc9	UTSW	15	72801324	small insertion	probably benign
RF023:Trappc9	UTSW	15	72801331	small insertion	probably benign
RF028:Trappc9	UTSW	15	72801290	small insertion	probably benign
RF029:Trappc9	UTSW	15	72801323	small insertion	probably benign
RF030:Trappc9	UTSW	15	72801325	small insertion	probably benign
RF034:Trappc9	UTSW	15	72801298	small insertion	probably benign
RF036:Trappc9	UTSW	15	72801320	small insertion	probably benign
RF038:Trappc9	UTSW	15	72801323	small insertion	probably benign
RF040:Trappc9	UTSW	15	72801292	small insertion	probably benign
RF042:Trappc9	UTSW	15	72801283	small insertion	probably benign
RF043:Trappc9	UTSW	15	72801305	small insertion	probably benign
RF049:Trappc9	UTSW	15	72801301	small insertion	probably benign
RF049:Trappc9	UTSW	15	72801306	small insertion	probably benign
RF053:Trappc9	UTSW	15	72801328	small insertion	probably benign
RF057:Trappc9	UTSW	15	72801295	small insertion	probably benign
RF063:Trappc9	UTSW	15	72801320	small insertion	probably benign
RF063:Trappc9	UTSW	15	72801324	small insertion	probably benign
Z1177:Trappc9	UTSW	15	73052162	missense	probably null	0.51

Predicted Primers

PCR Primer
(F):5'- ACGCTGAAGTATAATCTACAGGTTGG -3'
(R):5'- TGGAAAATCTTCACAGAGTGGG -3'

Sequencing Primer
(F):5'- GGAGATGGCCTCTTTGTA -3'
(R):5'- GAGTTAGTTAACACTGCACACCGTG -3'

Posted On

2015-04-29