Incidental Mutation 'R4012:Trappc9'
ID 311780
Institutional Source Beutler Lab
Gene Symbol Trappc9
Ensembl Gene ENSMUSG00000047921
Gene Name trafficking protein particle complex 9
Synonyms TRS130, Nibp, 2900005P22Rik, 4632408O18Rik, 1810044A24Rik
MMRRC Submission 040949-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R4012 (G1)
Quality Score 225
Status Validated
Chromosome 15
Chromosomal Location 72589620-73061204 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 73031623 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Valine at position 303 (I303V)
Ref Sequence ENSEMBL: ENSMUSP00000131997 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023276] [ENSMUST00000089770] [ENSMUST00000168191] [ENSMUST00000170633] [ENSMUST00000228960]
AlphaFold no structure available at present
Predicted Effect possibly damaging
Transcript: ENSMUST00000023276
AA Change: I115V

PolyPhen 2 Score 0.951 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000023276
Gene: ENSMUSG00000047921
AA Change: I115V

DomainStartEndE-ValueType
Pfam:TRAPPC9-Trs120 2 920 3.6e-239 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000089770
AA Change: I294V

PolyPhen 2 Score 0.897 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000087202
Gene: ENSMUSG00000047921
AA Change: I294V

DomainStartEndE-ValueType
Pfam:TRAPPC9-Trs120 182 350 4.1e-20 PFAM
Pfam:TRAPPC9-Trs120 434 664 2.2e-16 PFAM
low complexity region 993 1004 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000168191
AA Change: I294V

PolyPhen 2 Score 0.161 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000131295
Gene: ENSMUSG00000047921
AA Change: I294V

DomainStartEndE-ValueType
Pfam:TRAPPC9-Trs120 1 810 3.7e-222 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000170633
AA Change: I303V

PolyPhen 2 Score 0.952 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000131997
Gene: ENSMUSG00000047921
AA Change: I303V

DomainStartEndE-ValueType
Pfam:TRAPPC9-Trs120 1 820 7.6e-224 PFAM
coiled coil region 857 885 N/A INTRINSIC
low complexity region 906 929 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000228960
AA Change: I294V

PolyPhen 2 Score 0.288 (Sensitivity: 0.91; Specificity: 0.88)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000230025
Predicted Effect noncoding transcript
Transcript: ENSMUST00000230270
Meta Mutation Damage Score 0.1174 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 93.0%
Validation Efficiency 100% (79/79)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that likely plays a role in NF-kappa-B signaling. Mutations in this gene have been associated with autosomal-recessive mental retardation. Alternatively spliced transcript variants have been described.[provided by RefSeq, Feb 2010]
Allele List at MGI
Other mutations in this stock
Total: 79 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700015F17Rik A C 5: 5,478,955 L20R probably damaging Het
2210016F16Rik T A 13: 58,381,986 K271* probably null Het
9930021J03Rik T G 19: 29,743,590 K622N probably damaging Het
Adnp2 G T 18: 80,130,821 F124L probably benign Het
Aicda A G 6: 122,559,490 K10E probably benign Het
Als2 A G 1: 59,187,416 C910R probably benign Het
Ankrd11 T A 8: 122,892,417 K1565N probably damaging Het
Apol7b T C 15: 77,424,709 D63G probably damaging Het
Arhgef4 T C 1: 34,725,106 C1148R possibly damaging Het
Atg16l1 A G 1: 87,766,907 D102G probably damaging Het
Babam2 T C 5: 32,001,438 V244A probably damaging Het
Cars G A 7: 143,559,674 A668V possibly damaging Het
Ccdc185 T A 1: 182,748,888 S79C possibly damaging Het
Ccdc88b G C 19: 6,848,991 R1119G probably damaging Het
Cebpz A T 17: 78,924,467 V810E probably damaging Het
Cep120 T C 18: 53,738,582 T73A probably damaging Het
Chat C A 14: 32,423,312 C380F possibly damaging Het
Cltc T C 11: 86,757,261 Q10R probably benign Het
Cst8 T C 2: 148,804,702 probably benign Het
Cts3 C T 13: 61,568,054 probably null Het
Cyp4a29 T A 4: 115,248,510 D136E probably benign Het
Dmxl2 A C 9: 54,379,013 probably null Het
Dsg4 T A 18: 20,451,862 V211E possibly damaging Het
Efcab5 C T 11: 77,117,830 V957I probably damaging Het
Eif4g2 A T 7: 111,074,151 L807Q possibly damaging Het
Epha4 A G 1: 77,390,094 probably benign Het
Epm2aip1 A T 9: 111,272,390 I144F probably benign Het
Erbb4 C T 1: 68,560,576 R114H probably damaging Het
Fabp3 C T 4: 130,312,387 T57I probably benign Het
Fam170a C T 18: 50,281,971 A228V probably damaging Het
Foxred1 A T 9: 35,206,275 M254K possibly damaging Het
Gm1527 T A 3: 28,898,820 C90S probably benign Het
Gm16286 A G 18: 80,212,124 D211G probably benign Het
Gm8251 T C 1: 44,060,969 D323G possibly damaging Het
Gpr137b T C 13: 13,359,362 T370A probably benign Het
Gtf2e2 A G 8: 33,755,965 probably benign Het
Hgsnat A T 8: 25,955,789 L359* probably null Het
Hhip A T 8: 79,992,594 C435S probably damaging Het
Hoxa13 T C 6: 52,259,127 D310G possibly damaging Het
Hspa14 T C 2: 3,512,638 Y18C probably damaging Het
Ighg1 A G 12: 113,329,650 V140A probably damaging Het
Ighv1-58 A T 12: 115,312,310 Y69* probably null Het
Inpp5j A G 11: 3,500,185 F615L probably benign Het
Kcna1 T A 6: 126,642,910 Y149F probably benign Het
Kcnj6 A T 16: 94,825,018 probably null Het
Krtap4-1 G T 11: 99,627,811 C124* probably null Het
Lama1 T A 17: 67,812,373 L2615* probably null Het
Lcp2 A T 11: 34,068,439 I72F probably damaging Het
Med1 T A 11: 98,171,706 I189F possibly damaging Het
Meioc C T 11: 102,675,828 R757C probably damaging Het
Mtr T A 13: 12,189,397 H1171L probably damaging Het
Mtr G C 13: 12,189,398 H1171D probably damaging Het
Nlrc5 A G 8: 94,475,992 Y240C possibly damaging Het
Nsun4 T A 4: 116,051,062 H767L possibly damaging Het
Pcdha1 T A 18: 36,931,136 N284K probably benign Het
Pcdhgb8 A C 18: 37,763,361 S495R probably benign Het
Pramel1 T A 4: 143,396,690 I79N possibly damaging Het
Prdm6 A T 18: 53,540,318 E183D possibly damaging Het
Prex2 T C 1: 11,184,516 F1125L probably benign Het
Prkg2 T C 5: 98,979,815 I346V possibly damaging Het
Ptprz1 A G 6: 23,002,585 D1558G probably damaging Het
Rab11fip3 GCTCGTCT GCT 17: 26,068,028 probably null Het
Rin2 C T 2: 145,860,446 T354I probably benign Het
S100a6 A G 3: 90,614,201 D50G probably damaging Het
Shroom3 T A 5: 92,948,483 probably benign Het
Sipa1l1 G A 12: 82,341,782 V261M possibly damaging Het
Slc5a4b T A 10: 76,074,992 I337F probably damaging Het
Smarcc1 A G 9: 110,132,205 Y30C possibly damaging Het
Swap70 A G 7: 110,281,305 K576E possibly damaging Het
Syt6 A G 3: 103,625,493 probably benign Het
Szt2 T C 4: 118,383,900 I1726V probably benign Het
Tdgf1 C T 9: 110,940,713 M169I probably benign Het
Thoc1 A G 18: 9,987,651 K453E possibly damaging Het
Tmem38b A G 4: 53,854,409 I214V probably benign Het
Tonsl A T 15: 76,637,044 I354N probably damaging Het
Trim66 A G 7: 109,458,131 S1032P probably damaging Het
Tsc22d4 T C 5: 137,758,328 V6A probably benign Het
Ubtd2 A G 11: 32,499,260 K36E probably benign Het
Zkscan2 T C 7: 123,498,660 E171G possibly damaging Het
Other mutations in Trappc9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00092:Trappc9 APN 15 73026026 missense possibly damaging 0.79
IGL01348:Trappc9 APN 15 72937009 missense possibly damaging 0.64
IGL01367:Trappc9 APN 15 72590153 missense probably benign 0.31
IGL01521:Trappc9 APN 15 73052167 missense probably damaging 1.00
IGL01726:Trappc9 APN 15 72946122 missense probably damaging 0.98
IGL01881:Trappc9 APN 15 72999992 missense probably damaging 1.00
IGL02214:Trappc9 APN 15 73012882 nonsense probably null
IGL02693:Trappc9 APN 15 72963693 splice site probably benign
IGL03229:Trappc9 APN 15 73058456 missense probably damaging 1.00
basilio UTSW 15 73058393 missense probably damaging 1.00
Boomboom UTSW 15 72736869 nonsense probably null
bronto UTSW 15 73058238 nonsense probably null
Earl UTSW 15 72736777 nonsense probably null
Sotto_aceto UTSW 15 72685339 missense probably damaging 0.99
P0026:Trappc9 UTSW 15 72953082 missense probably damaging 1.00
PIT4453001:Trappc9 UTSW 15 73031598 frame shift probably null
PIT4519001:Trappc9 UTSW 15 72953094 missense probably benign
R0001:Trappc9 UTSW 15 72963662 missense probably damaging 1.00
R0094:Trappc9 UTSW 15 72894929 intron probably benign
R0745:Trappc9 UTSW 15 73025967 missense probably damaging 1.00
R0747:Trappc9 UTSW 15 73025967 missense probably damaging 1.00
R0800:Trappc9 UTSW 15 72953132 splice site probably benign
R0816:Trappc9 UTSW 15 73025967 missense probably damaging 1.00
R0819:Trappc9 UTSW 15 73025967 missense probably damaging 1.00
R0820:Trappc9 UTSW 15 73025967 missense probably damaging 1.00
R0893:Trappc9 UTSW 15 72590107 missense probably damaging 1.00
R0976:Trappc9 UTSW 15 72999974 missense probably damaging 0.99
R1119:Trappc9 UTSW 15 73025967 missense probably damaging 1.00
R1266:Trappc9 UTSW 15 73025967 missense probably damaging 1.00
R1453:Trappc9 UTSW 15 73025967 missense probably damaging 1.00
R1454:Trappc9 UTSW 15 73025967 missense probably damaging 1.00
R1531:Trappc9 UTSW 15 72693548 nonsense probably null
R1543:Trappc9 UTSW 15 73025967 missense probably damaging 1.00
R1563:Trappc9 UTSW 15 73025967 missense probably damaging 1.00
R1565:Trappc9 UTSW 15 73025967 missense probably damaging 1.00
R1600:Trappc9 UTSW 15 72937109 nonsense probably null
R1712:Trappc9 UTSW 15 73025967 missense probably damaging 1.00
R1756:Trappc9 UTSW 15 73025967 missense probably damaging 1.00
R1789:Trappc9 UTSW 15 73025967 missense probably damaging 1.00
R1978:Trappc9 UTSW 15 73000025 missense probably damaging 1.00
R2001:Trappc9 UTSW 15 73058036 missense probably damaging 0.99
R2312:Trappc9 UTSW 15 73025967 missense probably damaging 1.00
R2334:Trappc9 UTSW 15 73025967 missense probably damaging 1.00
R2926:Trappc9 UTSW 15 73025967 missense probably damaging 1.00
R3123:Trappc9 UTSW 15 73025967 missense probably damaging 1.00
R3124:Trappc9 UTSW 15 73025967 missense probably damaging 1.00
R3125:Trappc9 UTSW 15 73025967 missense probably damaging 1.00
R3813:Trappc9 UTSW 15 73058393 missense probably damaging 1.00
R4080:Trappc9 UTSW 15 72941947 missense probably damaging 1.00
R4282:Trappc9 UTSW 15 72590792 missense probably damaging 1.00
R4572:Trappc9 UTSW 15 72937067 missense possibly damaging 0.61
R4739:Trappc9 UTSW 15 72937060 missense probably damaging 0.97
R4959:Trappc9 UTSW 15 72937056 missense probably damaging 1.00
R4973:Trappc9 UTSW 15 72937056 missense probably damaging 1.00
R5123:Trappc9 UTSW 15 72913366 intron probably benign
R5128:Trappc9 UTSW 15 73058393 missense probably damaging 1.00
R5228:Trappc9 UTSW 15 73057995 missense probably damaging 1.00
R5362:Trappc9 UTSW 15 73058217 missense possibly damaging 0.68
R5802:Trappc9 UTSW 15 72685339 missense probably damaging 0.99
R6032:Trappc9 UTSW 15 72925530 missense probably benign 0.43
R6032:Trappc9 UTSW 15 72925530 missense probably benign 0.43
R6154:Trappc9 UTSW 15 73058081 missense probably benign 0.03
R6372:Trappc9 UTSW 15 72590074 missense possibly damaging 0.75
R6661:Trappc9 UTSW 15 72590144 missense possibly damaging 0.55
R6864:Trappc9 UTSW 15 72937162 splice site probably null
R6893:Trappc9 UTSW 15 72925650 missense possibly damaging 0.93
R7099:Trappc9 UTSW 15 72693619 missense probably benign 0.00
R7276:Trappc9 UTSW 15 73052270 missense probably damaging 0.99
R7349:Trappc9 UTSW 15 72736869 nonsense probably null
R8260:Trappc9 UTSW 15 72941909 nonsense probably null
R8399:Trappc9 UTSW 15 73052282 missense probably damaging 1.00
R8683:Trappc9 UTSW 15 73012815 missense probably benign 0.26
R8839:Trappc9 UTSW 15 73058238 nonsense probably null
R8945:Trappc9 UTSW 15 73058096 missense probably benign
R9083:Trappc9 UTSW 15 72736777 nonsense probably null
R9323:Trappc9 UTSW 15 72693582 missense probably benign 0.41
R9329:Trappc9 UTSW 15 72801353 missense unknown
R9366:Trappc9 UTSW 15 72937088 missense probably benign
R9723:Trappc9 UTSW 15 72590114 missense possibly damaging 0.87
RF008:Trappc9 UTSW 15 72801289 small insertion probably benign
RF009:Trappc9 UTSW 15 72801287 small insertion probably benign
RF014:Trappc9 UTSW 15 72801283 small insertion probably benign
RF016:Trappc9 UTSW 15 72801289 small insertion probably benign
RF023:Trappc9 UTSW 15 72801324 small insertion probably benign
RF023:Trappc9 UTSW 15 72801331 small insertion probably benign
RF028:Trappc9 UTSW 15 72801290 small insertion probably benign
RF029:Trappc9 UTSW 15 72801323 small insertion probably benign
RF030:Trappc9 UTSW 15 72801325 small insertion probably benign
RF034:Trappc9 UTSW 15 72801298 small insertion probably benign
RF036:Trappc9 UTSW 15 72801320 small insertion probably benign
RF038:Trappc9 UTSW 15 72801323 small insertion probably benign
RF040:Trappc9 UTSW 15 72801292 small insertion probably benign
RF042:Trappc9 UTSW 15 72801283 small insertion probably benign
RF043:Trappc9 UTSW 15 72801305 small insertion probably benign
RF049:Trappc9 UTSW 15 72801301 small insertion probably benign
RF049:Trappc9 UTSW 15 72801306 small insertion probably benign
RF053:Trappc9 UTSW 15 72801328 small insertion probably benign
RF057:Trappc9 UTSW 15 72801295 small insertion probably benign
RF063:Trappc9 UTSW 15 72801320 small insertion probably benign
RF063:Trappc9 UTSW 15 72801324 small insertion probably benign
Z1177:Trappc9 UTSW 15 73052162 missense probably null 0.51
Predicted Primers PCR Primer
(F):5'- ACGCTGAAGTATAATCTACAGGTTGG -3'
(R):5'- TGGAAAATCTTCACAGAGTGGG -3'

Sequencing Primer
(F):5'- GGAGATGGCCTCTTTGTA -3'
(R):5'- GAGTTAGTTAACACTGCACACCGTG -3'
Posted On 2015-04-29