Mutagenetix > Incidental Mutation

Incidental Mutation 'R4012:Trappc9'

311780

Institutional Source

Beutler Lab

Gene Symbol

Trappc9

Ensembl Gene

ENSMUSG00000047921

Gene Name

trafficking protein particle complex 9

Synonyms

TRS130, Nibp, 2900005P22Rik, 4632408O18Rik, 1810044A24Rik

MMRRC Submission

040949-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R4012 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

72589620-73061204 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 73031623 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Valine at position 303 (I303V)

Ref Sequence

ENSEMBL: ENSMUSP00000131997 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000023276] [ENSMUST00000089770] [ENSMUST00000168191] [ENSMUST00000170633] [ENSMUST00000228960]

AlphaFold

no structure available at present

Predicted Effect

possibly damaging
Transcript: ENSMUST00000023276
AA Change: I115V

PolyPhen 2 Score 0.951 (Sensitivity: 0.79; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000023276
Gene: ENSMUSG00000047921
AA Change: I115V

Domain	Start	End	E-Value	Type
Pfam:TRAPPC9-Trs120	2	920	3.6e-239	PFAM

Predicted Effect

possibly damaging
Transcript: ENSMUST00000089770
AA Change: I294V

PolyPhen 2 Score 0.897 (Sensitivity: 0.82; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000087202
Gene: ENSMUSG00000047921
AA Change: I294V

Domain	Start	End	E-Value	Type
Pfam:TRAPPC9-Trs120	182	350	4.1e-20	PFAM
Pfam:TRAPPC9-Trs120	434	664	2.2e-16	PFAM
low complexity region	993	1004	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000168191
AA Change: I294V

PolyPhen 2 Score 0.161 (Sensitivity: 0.92; Specificity: 0.87)

SMART Domains

Protein: ENSMUSP00000131295
Gene: ENSMUSG00000047921
AA Change: I294V

Domain	Start	End	E-Value	Type
Pfam:TRAPPC9-Trs120	1	810	3.7e-222	PFAM

Predicted Effect

possibly damaging
Transcript: ENSMUST00000170633
AA Change: I303V

PolyPhen 2 Score 0.952 (Sensitivity: 0.79; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000131997
Gene: ENSMUSG00000047921
AA Change: I303V

Domain	Start	End	E-Value	Type
Pfam:TRAPPC9-Trs120	1	820	7.6e-224	PFAM
coiled coil region	857	885	N/A	INTRINSIC
low complexity region	906	929	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000228960
AA Change: I294V

PolyPhen 2 Score 0.288 (Sensitivity: 0.91; Specificity: 0.88)

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000230025

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000230270

Meta Mutation Damage Score

0.1174

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 96.8%
20x: 93.0%

Validation Efficiency

100% (79/79)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that likely plays a role in NF-kappa-B signaling. Mutations in this gene have been associated with autosomal-recessive mental retardation. Alternatively spliced transcript variants have been described.[provided by RefSeq, Feb 2010]

Allele List at MGI

Other mutations in this stock

Total: 79 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700015F17Rik	A	C	5: 5,478,955	L20R	probably damaging	Het
2210016F16Rik	T	A	13: 58,381,986	K271*	probably null	Het
9930021J03Rik	T	G	19: 29,743,590	K622N	probably damaging	Het
Adnp2	G	T	18: 80,130,821	F124L	probably benign	Het
Aicda	A	G	6: 122,559,490	K10E	probably benign	Het
Als2	A	G	1: 59,187,416	C910R	probably benign	Het
Ankrd11	T	A	8: 122,892,417	K1565N	probably damaging	Het
Apol7b	T	C	15: 77,424,709	D63G	probably damaging	Het
Arhgef4	T	C	1: 34,725,106	C1148R	possibly damaging	Het
Atg16l1	A	G	1: 87,766,907	D102G	probably damaging	Het
Babam2	T	C	5: 32,001,438	V244A	probably damaging	Het
Cars	G	A	7: 143,559,674	A668V	possibly damaging	Het
Ccdc185	T	A	1: 182,748,888	S79C	possibly damaging	Het
Ccdc88b	G	C	19: 6,848,991	R1119G	probably damaging	Het
Cebpz	A	T	17: 78,924,467	V810E	probably damaging	Het
Cep120	T	C	18: 53,738,582	T73A	probably damaging	Het
Chat	C	A	14: 32,423,312	C380F	possibly damaging	Het
Cltc	T	C	11: 86,757,261	Q10R	probably benign	Het
Cst8	T	C	2: 148,804,702		probably benign	Het
Cts3	C	T	13: 61,568,054		probably null	Het
Cyp4a29	T	A	4: 115,248,510	D136E	probably benign	Het
Dmxl2	A	C	9: 54,379,013		probably null	Het
Dsg4	T	A	18: 20,451,862	V211E	possibly damaging	Het
Efcab5	C	T	11: 77,117,830	V957I	probably damaging	Het
Eif4g2	A	T	7: 111,074,151	L807Q	possibly damaging	Het
Epha4	A	G	1: 77,390,094		probably benign	Het
Epm2aip1	A	T	9: 111,272,390	I144F	probably benign	Het
Erbb4	C	T	1: 68,560,576	R114H	probably damaging	Het
Fabp3	C	T	4: 130,312,387	T57I	probably benign	Het
Fam170a	C	T	18: 50,281,971	A228V	probably damaging	Het
Foxred1	A	T	9: 35,206,275	M254K	possibly damaging	Het
Gm1527	T	A	3: 28,898,820	C90S	probably benign	Het
Gm16286	A	G	18: 80,212,124	D211G	probably benign	Het
Gm8251	T	C	1: 44,060,969	D323G	possibly damaging	Het
Gpr137b	T	C	13: 13,359,362	T370A	probably benign	Het
Gtf2e2	A	G	8: 33,755,965		probably benign	Het
Hgsnat	A	T	8: 25,955,789	L359*	probably null	Het
Hhip	A	T	8: 79,992,594	C435S	probably damaging	Het
Hoxa13	T	C	6: 52,259,127	D310G	possibly damaging	Het
Hspa14	T	C	2: 3,512,638	Y18C	probably damaging	Het
Ighg1	A	G	12: 113,329,650	V140A	probably damaging	Het
Ighv1-58	A	T	12: 115,312,310	Y69*	probably null	Het
Inpp5j	A	G	11: 3,500,185	F615L	probably benign	Het
Kcna1	T	A	6: 126,642,910	Y149F	probably benign	Het
Kcnj6	A	T	16: 94,825,018		probably null	Het
Krtap4-1	G	T	11: 99,627,811	C124*	probably null	Het
Lama1	T	A	17: 67,812,373	L2615*	probably null	Het
Lcp2	A	T	11: 34,068,439	I72F	probably damaging	Het
Med1	T	A	11: 98,171,706	I189F	possibly damaging	Het
Meioc	C	T	11: 102,675,828	R757C	probably damaging	Het
Mtr	T	A	13: 12,189,397	H1171L	probably damaging	Het
Mtr	G	C	13: 12,189,398	H1171D	probably damaging	Het
Nlrc5	A	G	8: 94,475,992	Y240C	possibly damaging	Het
Nsun4	T	A	4: 116,051,062	H767L	possibly damaging	Het
Pcdha1	T	A	18: 36,931,136	N284K	probably benign	Het
Pcdhgb8	A	C	18: 37,763,361	S495R	probably benign	Het
Pramel1	T	A	4: 143,396,690	I79N	possibly damaging	Het
Prdm6	A	T	18: 53,540,318	E183D	possibly damaging	Het
Prex2	T	C	1: 11,184,516	F1125L	probably benign	Het
Prkg2	T	C	5: 98,979,815	I346V	possibly damaging	Het
Ptprz1	A	G	6: 23,002,585	D1558G	probably damaging	Het
Rab11fip3	GCTCGTCT	GCT	17: 26,068,028		probably null	Het
Rin2	C	T	2: 145,860,446	T354I	probably benign	Het
S100a6	A	G	3: 90,614,201	D50G	probably damaging	Het
Shroom3	T	A	5: 92,948,483		probably benign	Het
Sipa1l1	G	A	12: 82,341,782	V261M	possibly damaging	Het
Slc5a4b	T	A	10: 76,074,992	I337F	probably damaging	Het
Smarcc1	A	G	9: 110,132,205	Y30C	possibly damaging	Het
Swap70	A	G	7: 110,281,305	K576E	possibly damaging	Het
Syt6	A	G	3: 103,625,493		probably benign	Het
Szt2	T	C	4: 118,383,900	I1726V	probably benign	Het
Tdgf1	C	T	9: 110,940,713	M169I	probably benign	Het
Thoc1	A	G	18: 9,987,651	K453E	possibly damaging	Het
Tmem38b	A	G	4: 53,854,409	I214V	probably benign	Het
Tonsl	A	T	15: 76,637,044	I354N	probably damaging	Het
Trim66	A	G	7: 109,458,131	S1032P	probably damaging	Het
Tsc22d4	T	C	5: 137,758,328	V6A	probably benign	Het
Ubtd2	A	G	11: 32,499,260	K36E	probably benign	Het
Zkscan2	T	C	7: 123,498,660	E171G	possibly damaging	Het

Other mutations in Trappc9

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00092:Trappc9	APN	15	73026026	missense	possibly damaging	0.79
IGL01348:Trappc9	APN	15	72937009	missense	possibly damaging	0.64
IGL01367:Trappc9	APN	15	72590153	missense	probably benign	0.31
IGL01521:Trappc9	APN	15	73052167	missense	probably damaging	1.00
IGL01726:Trappc9	APN	15	72946122	missense	probably damaging	0.98
IGL01881:Trappc9	APN	15	72999992	missense	probably damaging	1.00
IGL02214:Trappc9	APN	15	73012882	nonsense	probably null
IGL02693:Trappc9	APN	15	72963693	splice site	probably benign
IGL03229:Trappc9	APN	15	73058456	missense	probably damaging	1.00
basilio	UTSW	15	73058393	missense	probably damaging	1.00
Boomboom	UTSW	15	72736869	nonsense	probably null
bronto	UTSW	15	73058238	nonsense	probably null
Earl	UTSW	15	72736777	nonsense	probably null
Sotto_aceto	UTSW	15	72685339	missense	probably damaging	0.99
P0026:Trappc9	UTSW	15	72953082	missense	probably damaging	1.00
PIT4453001:Trappc9	UTSW	15	73031598	frame shift	probably null
PIT4519001:Trappc9	UTSW	15	72953094	missense	probably benign
R0001:Trappc9	UTSW	15	72963662	missense	probably damaging	1.00
R0094:Trappc9	UTSW	15	72894929	intron	probably benign
R0745:Trappc9	UTSW	15	73025967	missense	probably damaging	1.00
R0747:Trappc9	UTSW	15	73025967	missense	probably damaging	1.00
R0800:Trappc9	UTSW	15	72953132	splice site	probably benign
R0816:Trappc9	UTSW	15	73025967	missense	probably damaging	1.00
R0819:Trappc9	UTSW	15	73025967	missense	probably damaging	1.00
R0820:Trappc9	UTSW	15	73025967	missense	probably damaging	1.00
R0893:Trappc9	UTSW	15	72590107	missense	probably damaging	1.00
R0976:Trappc9	UTSW	15	72999974	missense	probably damaging	0.99
R1119:Trappc9	UTSW	15	73025967	missense	probably damaging	1.00
R1266:Trappc9	UTSW	15	73025967	missense	probably damaging	1.00
R1453:Trappc9	UTSW	15	73025967	missense	probably damaging	1.00
R1454:Trappc9	UTSW	15	73025967	missense	probably damaging	1.00
R1531:Trappc9	UTSW	15	72693548	nonsense	probably null
R1543:Trappc9	UTSW	15	73025967	missense	probably damaging	1.00
R1563:Trappc9	UTSW	15	73025967	missense	probably damaging	1.00
R1565:Trappc9	UTSW	15	73025967	missense	probably damaging	1.00
R1600:Trappc9	UTSW	15	72937109	nonsense	probably null
R1712:Trappc9	UTSW	15	73025967	missense	probably damaging	1.00
R1756:Trappc9	UTSW	15	73025967	missense	probably damaging	1.00
R1789:Trappc9	UTSW	15	73025967	missense	probably damaging	1.00
R1978:Trappc9	UTSW	15	73000025	missense	probably damaging	1.00
R2001:Trappc9	UTSW	15	73058036	missense	probably damaging	0.99
R2312:Trappc9	UTSW	15	73025967	missense	probably damaging	1.00
R2334:Trappc9	UTSW	15	73025967	missense	probably damaging	1.00
R2926:Trappc9	UTSW	15	73025967	missense	probably damaging	1.00
R3123:Trappc9	UTSW	15	73025967	missense	probably damaging	1.00
R3124:Trappc9	UTSW	15	73025967	missense	probably damaging	1.00
R3125:Trappc9	UTSW	15	73025967	missense	probably damaging	1.00
R3813:Trappc9	UTSW	15	73058393	missense	probably damaging	1.00
R4080:Trappc9	UTSW	15	72941947	missense	probably damaging	1.00
R4282:Trappc9	UTSW	15	72590792	missense	probably damaging	1.00
R4572:Trappc9	UTSW	15	72937067	missense	possibly damaging	0.61
R4739:Trappc9	UTSW	15	72937060	missense	probably damaging	0.97
R4959:Trappc9	UTSW	15	72937056	missense	probably damaging	1.00
R4973:Trappc9	UTSW	15	72937056	missense	probably damaging	1.00
R5123:Trappc9	UTSW	15	72913366	intron	probably benign
R5128:Trappc9	UTSW	15	73058393	missense	probably damaging	1.00
R5228:Trappc9	UTSW	15	73057995	missense	probably damaging	1.00
R5362:Trappc9	UTSW	15	73058217	missense	possibly damaging	0.68
R5802:Trappc9	UTSW	15	72685339	missense	probably damaging	0.99
R6032:Trappc9	UTSW	15	72925530	missense	probably benign	0.43
R6032:Trappc9	UTSW	15	72925530	missense	probably benign	0.43
R6154:Trappc9	UTSW	15	73058081	missense	probably benign	0.03
R6372:Trappc9	UTSW	15	72590074	missense	possibly damaging	0.75
R6661:Trappc9	UTSW	15	72590144	missense	possibly damaging	0.55
R6864:Trappc9	UTSW	15	72937162	splice site	probably null
R6893:Trappc9	UTSW	15	72925650	missense	possibly damaging	0.93
R7099:Trappc9	UTSW	15	72693619	missense	probably benign	0.00
R7276:Trappc9	UTSW	15	73052270	missense	probably damaging	0.99
R7349:Trappc9	UTSW	15	72736869	nonsense	probably null
R8260:Trappc9	UTSW	15	72941909	nonsense	probably null
R8399:Trappc9	UTSW	15	73052282	missense	probably damaging	1.00
R8683:Trappc9	UTSW	15	73012815	missense	probably benign	0.26
R8839:Trappc9	UTSW	15	73058238	nonsense	probably null
R8945:Trappc9	UTSW	15	73058096	missense	probably benign
R9083:Trappc9	UTSW	15	72736777	nonsense	probably null
R9323:Trappc9	UTSW	15	72693582	missense	probably benign	0.41
R9329:Trappc9	UTSW	15	72801353	missense	unknown
R9366:Trappc9	UTSW	15	72937088	missense	probably benign
R9723:Trappc9	UTSW	15	72590114	missense	possibly damaging	0.87
RF008:Trappc9	UTSW	15	72801289	small insertion	probably benign
RF009:Trappc9	UTSW	15	72801287	small insertion	probably benign
RF014:Trappc9	UTSW	15	72801283	small insertion	probably benign
RF016:Trappc9	UTSW	15	72801289	small insertion	probably benign
RF023:Trappc9	UTSW	15	72801324	small insertion	probably benign
RF023:Trappc9	UTSW	15	72801331	small insertion	probably benign
RF028:Trappc9	UTSW	15	72801290	small insertion	probably benign
RF029:Trappc9	UTSW	15	72801323	small insertion	probably benign
RF030:Trappc9	UTSW	15	72801325	small insertion	probably benign
RF034:Trappc9	UTSW	15	72801298	small insertion	probably benign
RF036:Trappc9	UTSW	15	72801320	small insertion	probably benign
RF038:Trappc9	UTSW	15	72801323	small insertion	probably benign
RF040:Trappc9	UTSW	15	72801292	small insertion	probably benign
RF042:Trappc9	UTSW	15	72801283	small insertion	probably benign
RF043:Trappc9	UTSW	15	72801305	small insertion	probably benign
RF049:Trappc9	UTSW	15	72801301	small insertion	probably benign
RF049:Trappc9	UTSW	15	72801306	small insertion	probably benign
RF053:Trappc9	UTSW	15	72801328	small insertion	probably benign
RF057:Trappc9	UTSW	15	72801295	small insertion	probably benign
RF063:Trappc9	UTSW	15	72801320	small insertion	probably benign
RF063:Trappc9	UTSW	15	72801324	small insertion	probably benign
Z1177:Trappc9	UTSW	15	73052162	missense	probably null	0.51

Predicted Primers

PCR Primer
(F):5'- ACGCTGAAGTATAATCTACAGGTTGG -3'
(R):5'- TGGAAAATCTTCACAGAGTGGG -3'

Sequencing Primer
(F):5'- GGAGATGGCCTCTTTGTA -3'
(R):5'- GAGTTAGTTAACACTGCACACCGTG -3'

Posted On

2015-04-29