Mutagenetix > Incidental Mutation

Incidental Mutation 'R4012:Dsg4'

311788

Institutional Source

Beutler Lab

Gene Symbol

Dsg4

Ensembl Gene

ENSMUSG00000001804

Gene Name

desmoglein 4

Synonyms

lah, CDHF13

MMRRC Submission

040949-MU

Accession Numbers

Essential gene?

Probably essential (E-score: 0.768) question?

Stock #

R4012 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

20436175-20471821 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 20451862 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Valine to Glutamic Acid at position 211 (V211E)

Ref Sequence

ENSEMBL: ENSMUSP00000019426 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000019426]

AlphaFold

Q7TMD7

Predicted Effect

possibly damaging
Transcript: ENSMUST00000019426
AA Change: V211E

PolyPhen 2 Score 0.814 (Sensitivity: 0.84; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000019426
Gene: ENSMUSG00000001804
AA Change: V211E

Domain	Start	End	E-Value	Type
signal peptide	1	20	N/A	INTRINSIC
CA	70	155	1.54e-11	SMART
CA	179	267	4.27e-19	SMART
CA	290	384	5.48e-8	SMART
CA	411	495	9.4e-7	SMART
transmembrane domain	634	656	N/A	INTRINSIC
low complexity region	724	736	N/A	INTRINSIC
Pfam:Cadherin_C	749	849	3.1e-8	PFAM

Meta Mutation Damage Score

0.1795

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 96.8%
20x: 93.0%

Validation Efficiency

100% (79/79)

MGI Phenotype

FUNCTION: This gene encodes a member of the cadherin family of proteins that forms an integral transmembrane component of desmosomes, the multiprotein complexes involved in cell adhesion, organization of the cytoskeleton, cell sorting and cell signaling. This gene is expressed in the suprabasal epidermis and hair follicle. The encoded preproprotein undergoes proteolytic processing to generate a mature, functional protein. Certain mutations in this gene are responsible for the lanceolate hair phenotype in mice. This gene is located in a cluster of desmosomal cadherin genes on chromosome 18. [provided by RefSeq, Feb 2016]
PHENOTYPE: Mice carrying mutations at this locus exhibit abnormalities in hair growth, vibrissae growth, and a thickened epidermis. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 79 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700015F17Rik	A	C	5: 5,478,955	L20R	probably damaging	Het
2210016F16Rik	T	A	13: 58,381,986	K271*	probably null	Het
9930021J03Rik	T	G	19: 29,743,590	K622N	probably damaging	Het
Adnp2	G	T	18: 80,130,821	F124L	probably benign	Het
Aicda	A	G	6: 122,559,490	K10E	probably benign	Het
Als2	A	G	1: 59,187,416	C910R	probably benign	Het
Ankrd11	T	A	8: 122,892,417	K1565N	probably damaging	Het
Apol7b	T	C	15: 77,424,709	D63G	probably damaging	Het
Arhgef4	T	C	1: 34,725,106	C1148R	possibly damaging	Het
Atg16l1	A	G	1: 87,766,907	D102G	probably damaging	Het
Babam2	T	C	5: 32,001,438	V244A	probably damaging	Het
Cars	G	A	7: 143,559,674	A668V	possibly damaging	Het
Ccdc185	T	A	1: 182,748,888	S79C	possibly damaging	Het
Ccdc88b	G	C	19: 6,848,991	R1119G	probably damaging	Het
Cebpz	A	T	17: 78,924,467	V810E	probably damaging	Het
Cep120	T	C	18: 53,738,582	T73A	probably damaging	Het
Chat	C	A	14: 32,423,312	C380F	possibly damaging	Het
Cltc	T	C	11: 86,757,261	Q10R	probably benign	Het
Cst8	T	C	2: 148,804,702		probably benign	Het
Cts3	C	T	13: 61,568,054		probably null	Het
Cyp4a29	T	A	4: 115,248,510	D136E	probably benign	Het
Dmxl2	A	C	9: 54,379,013		probably null	Het
Efcab5	C	T	11: 77,117,830	V957I	probably damaging	Het
Eif4g2	A	T	7: 111,074,151	L807Q	possibly damaging	Het
Epha4	A	G	1: 77,390,094		probably benign	Het
Epm2aip1	A	T	9: 111,272,390	I144F	probably benign	Het
Erbb4	C	T	1: 68,560,576	R114H	probably damaging	Het
Fabp3	C	T	4: 130,312,387	T57I	probably benign	Het
Fam170a	C	T	18: 50,281,971	A228V	probably damaging	Het
Foxred1	A	T	9: 35,206,275	M254K	possibly damaging	Het
Gm1527	T	A	3: 28,898,820	C90S	probably benign	Het
Gm16286	A	G	18: 80,212,124	D211G	probably benign	Het
Gm8251	T	C	1: 44,060,969	D323G	possibly damaging	Het
Gpr137b	T	C	13: 13,359,362	T370A	probably benign	Het
Gtf2e2	A	G	8: 33,755,965		probably benign	Het
Hgsnat	A	T	8: 25,955,789	L359*	probably null	Het
Hhip	A	T	8: 79,992,594	C435S	probably damaging	Het
Hoxa13	T	C	6: 52,259,127	D310G	possibly damaging	Het
Hspa14	T	C	2: 3,512,638	Y18C	probably damaging	Het
Ighg1	A	G	12: 113,329,650	V140A	probably damaging	Het
Ighv1-58	A	T	12: 115,312,310	Y69*	probably null	Het
Inpp5j	A	G	11: 3,500,185	F615L	probably benign	Het
Kcna1	T	A	6: 126,642,910	Y149F	probably benign	Het
Kcnj6	A	T	16: 94,825,018		probably null	Het
Krtap4-1	G	T	11: 99,627,811	C124*	probably null	Het
Lama1	T	A	17: 67,812,373	L2615*	probably null	Het
Lcp2	A	T	11: 34,068,439	I72F	probably damaging	Het
Med1	T	A	11: 98,171,706	I189F	possibly damaging	Het
Meioc	C	T	11: 102,675,828	R757C	probably damaging	Het
Mtr	T	A	13: 12,189,397	H1171L	probably damaging	Het
Mtr	G	C	13: 12,189,398	H1171D	probably damaging	Het
Nlrc5	A	G	8: 94,475,992	Y240C	possibly damaging	Het
Nsun4	T	A	4: 116,051,062	H767L	possibly damaging	Het
Pcdha1	T	A	18: 36,931,136	N284K	probably benign	Het
Pcdhgb8	A	C	18: 37,763,361	S495R	probably benign	Het
Pramel1	T	A	4: 143,396,690	I79N	possibly damaging	Het
Prdm6	A	T	18: 53,540,318	E183D	possibly damaging	Het
Prex2	T	C	1: 11,184,516	F1125L	probably benign	Het
Prkg2	T	C	5: 98,979,815	I346V	possibly damaging	Het
Ptprz1	A	G	6: 23,002,585	D1558G	probably damaging	Het
Rab11fip3	GCTCGTCT	GCT	17: 26,068,028		probably null	Het
Rin2	C	T	2: 145,860,446	T354I	probably benign	Het
S100a6	A	G	3: 90,614,201	D50G	probably damaging	Het
Shroom3	T	A	5: 92,948,483		probably benign	Het
Sipa1l1	G	A	12: 82,341,782	V261M	possibly damaging	Het
Slc5a4b	T	A	10: 76,074,992	I337F	probably damaging	Het
Smarcc1	A	G	9: 110,132,205	Y30C	possibly damaging	Het
Swap70	A	G	7: 110,281,305	K576E	possibly damaging	Het
Syt6	A	G	3: 103,625,493		probably benign	Het
Szt2	T	C	4: 118,383,900	I1726V	probably benign	Het
Tdgf1	C	T	9: 110,940,713	M169I	probably benign	Het
Thoc1	A	G	18: 9,987,651	K453E	possibly damaging	Het
Tmem38b	A	G	4: 53,854,409	I214V	probably benign	Het
Tonsl	A	T	15: 76,637,044	I354N	probably damaging	Het
Trappc9	T	C	15: 73,031,623	I303V	possibly damaging	Het
Trim66	A	G	7: 109,458,131	S1032P	probably damaging	Het
Tsc22d4	T	C	5: 137,758,328	V6A	probably benign	Het
Ubtd2	A	G	11: 32,499,260	K36E	probably benign	Het
Zkscan2	T	C	7: 123,498,660	E171G	possibly damaging	Het

Other mutations in Dsg4

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00708:Dsg4	APN	18	20461326	missense	probably benign	0.22
IGL01723:Dsg4	APN	18	20466510	missense	probably damaging	1.00
IGL02249:Dsg4	APN	18	20461304	missense	possibly damaging	0.69
IGL02445:Dsg4	APN	18	20446250	splice site	probably benign
IGL02553:Dsg4	APN	18	20462520	missense	probably benign
IGL02578:Dsg4	APN	18	20471193	missense	possibly damaging	0.94
IGL02634:Dsg4	APN	18	20458580	missense	probably benign	0.01
IGL02677:Dsg4	APN	18	20464876	missense	possibly damaging	0.62
IGL02741:Dsg4	APN	18	20471496	missense	probably benign
IGL02747:Dsg4	APN	18	20446938	missense	probably damaging	0.97
IGL03342:Dsg4	APN	18	20451823	missense	probably damaging	1.00
burrito	UTSW	18	20451862	missense	possibly damaging	0.81
woodshed	UTSW	18	20451872	nonsense	probably null
R0043:Dsg4	UTSW	18	20452972	missense	probably damaging	1.00
R0375:Dsg4	UTSW	18	20470879	missense	probably damaging	1.00
R0537:Dsg4	UTSW	18	20458571	missense	probably damaging	1.00
R0619:Dsg4	UTSW	18	20461359	missense	probably benign	0.00
R0622:Dsg4	UTSW	18	20449788	missense	possibly damaging	0.51
R0765:Dsg4	UTSW	18	20454646	splice site	probably benign
R0786:Dsg4	UTSW	18	20449372	critical splice donor site	probably null
R1114:Dsg4	UTSW	18	20466483	missense	possibly damaging	0.62
R1249:Dsg4	UTSW	18	20446872	nonsense	probably null
R1372:Dsg4	UTSW	18	20449676	splice site	probably null
R1382:Dsg4	UTSW	18	20465124	missense	probably benign	0.00
R1392:Dsg4	UTSW	18	20446247	splice site	probably benign
R1442:Dsg4	UTSW	18	20462660	missense	possibly damaging	0.76
R1503:Dsg4	UTSW	18	20449679	missense	probably damaging	1.00
R1704:Dsg4	UTSW	18	20471589	missense	probably damaging	1.00
R1716:Dsg4	UTSW	18	20462461	nonsense	probably null
R1765:Dsg4	UTSW	18	20456831	missense	probably benign	0.01
R1817:Dsg4	UTSW	18	20471245	missense	probably damaging	1.00
R1982:Dsg4	UTSW	18	20471212	missense	probably damaging	1.00
R2025:Dsg4	UTSW	18	20466636	nonsense	probably null
R2097:Dsg4	UTSW	18	20471044	missense	probably damaging	1.00
R2198:Dsg4	UTSW	18	20461442	missense	probably benign
R3551:Dsg4	UTSW	18	20451756	missense	probably damaging	1.00
R3742:Dsg4	UTSW	18	20471001	missense	probably damaging	1.00
R3853:Dsg4	UTSW	18	20449234	missense	probably benign
R3955:Dsg4	UTSW	18	20449375	splice site	probably null
R4006:Dsg4	UTSW	18	20470965	missense	probably damaging	0.97
R4171:Dsg4	UTSW	18	20458579	nonsense	probably null
R4254:Dsg4	UTSW	18	20471538	missense	probably benign	0.07
R4504:Dsg4	UTSW	18	20461436	missense	probably benign	0.00
R4559:Dsg4	UTSW	18	20470921	missense	probably damaging	1.00
R4607:Dsg4	UTSW	18	20471245	missense	probably damaging	1.00
R4612:Dsg4	UTSW	18	20462413	missense	probably benign	0.10
R4683:Dsg4	UTSW	18	20461409	missense	probably benign
R4700:Dsg4	UTSW	18	20456908	missense	possibly damaging	0.91
R4749:Dsg4	UTSW	18	20446831	missense	possibly damaging	0.88
R4775:Dsg4	UTSW	18	20471127	missense	possibly damaging	0.48
R4809:Dsg4	UTSW	18	20466621	missense	possibly damaging	0.82
R5276:Dsg4	UTSW	18	20446839	missense	probably benign	0.21
R5426:Dsg4	UTSW	18	20458484	missense	probably damaging	1.00
R5767:Dsg4	UTSW	18	20462492	nonsense	probably null
R5982:Dsg4	UTSW	18	20465169	missense	possibly damaging	0.76
R6280:Dsg4	UTSW	18	20466667	missense	probably damaging	1.00
R6305:Dsg4	UTSW	18	20449790	missense	probably damaging	1.00
R6489:Dsg4	UTSW	18	20471363	missense	possibly damaging	0.93
R7013:Dsg4	UTSW	18	20458521	missense	possibly damaging	0.58
R7040:Dsg4	UTSW	18	20451852	missense	probably benign	0.01
R7196:Dsg4	UTSW	18	20466480	missense	probably damaging	1.00
R7432:Dsg4	UTSW	18	20446266	nonsense	probably null
R7438:Dsg4	UTSW	18	20466628	missense	probably damaging	0.96
R7490:Dsg4	UTSW	18	20451936	splice site	probably null
R7612:Dsg4	UTSW	18	20470990	missense	probably damaging	1.00
R7639:Dsg4	UTSW	18	20449712	missense	probably damaging	1.00
R7905:Dsg4	UTSW	18	20454669	missense	probably damaging	1.00
R8251:Dsg4	UTSW	18	20471164	missense	probably damaging	1.00
R8326:Dsg4	UTSW	18	20449731	missense	probably benign	0.31
R8554:Dsg4	UTSW	18	20453043	missense	probably damaging	1.00
R8911:Dsg4	UTSW	18	20451872	nonsense	probably null
R9059:Dsg4	UTSW	18	20471125	missense	possibly damaging	0.62
R9508:Dsg4	UTSW	18	20471013	missense	probably damaging	1.00
R9607:Dsg4	UTSW	18	20452990	missense	probably benign	0.00
R9765:Dsg4	UTSW	18	20471277	missense	probably benign	0.02

Predicted Primers

PCR Primer
(F):5'- CTCAAGGAAGTCGGGAAAATTC -3'
(R):5'- GGTGCATAAAACGAAATCTGTATCAC -3'

Sequencing Primer
(F):5'- CTTTTTATACCTAATGCCTGGAGG -3'
(R):5'- TAAAACGAAATCTGTATCACTGACC -3'

Posted On

2015-04-29