Incidental Mutation 'R4012:Ccdc88b'
ID 311795
Institutional Source Beutler Lab
Gene Symbol Ccdc88b
Ensembl Gene ENSMUSG00000047810
Gene Name coiled-coil domain containing 88B
Synonyms 2610041P08Rik
MMRRC Submission 040949-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R4012 (G1)
Quality Score 188
Status Validated
Chromosome 19
Chromosomal Location 6821991-6835579 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to C at 6826359 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Arginine to Glycine at position 1119 (R1119G)
Ref Sequence ENSEMBL: ENSMUSP00000109067 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000113440]
AlphaFold Q4QRL3
Predicted Effect probably damaging
Transcript: ENSMUST00000113440
AA Change: R1119G

PolyPhen 2 Score 0.982 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000109067
Gene: ENSMUSG00000047810
AA Change: R1119G

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
low complexity region 29 50 N/A INTRINSIC
Pfam:HOOK 91 503 1.2e-16 PFAM
coiled coil region 731 1308 N/A INTRINSIC
low complexity region 1420 1429 N/A INTRINSIC
Meta Mutation Damage Score 0.0911 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 93.0%
Validation Efficiency 100% (79/79)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the hook-related protein family. Members of this family are characterized by an N-terminal potential microtubule binding domain, a central coiled-coiled and a C-terminal Hook-related domain. The encoded protein may be involved in linking organelles to microtubules. [provided by RefSeq, Oct 2009]
PHENOTYPE: Mice homozygous for a null ENU-induced allele exhibit decreased susceptibility to P. berghei infection with reduced T cell proliferation, decreased cytokine secretion and increased myeloid cell number. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 79 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adnp2 G T 18: 80,174,036 (GRCm39) F124L probably benign Het
Aicda A G 6: 122,536,449 (GRCm39) K10E probably benign Het
Als2 A G 1: 59,226,575 (GRCm39) C910R probably benign Het
Ankrd11 T A 8: 123,619,156 (GRCm39) K1565N probably damaging Het
Apol7b T C 15: 77,308,909 (GRCm39) D63G probably damaging Het
Arhgef4 T C 1: 34,764,187 (GRCm39) C1148R possibly damaging Het
Atg16l1 A G 1: 87,694,629 (GRCm39) D102G probably damaging Het
Babam2 T C 5: 32,158,782 (GRCm39) V244A probably damaging Het
Brd10 T G 19: 29,720,990 (GRCm39) K622N probably damaging Het
Cars1 G A 7: 143,113,411 (GRCm39) A668V possibly damaging Het
Ccdc168 T C 1: 44,100,129 (GRCm39) D323G possibly damaging Het
Ccdc185 T A 1: 182,576,453 (GRCm39) S79C possibly damaging Het
Cebpz A T 17: 79,231,896 (GRCm39) V810E probably damaging Het
Cep120 T C 18: 53,871,654 (GRCm39) T73A probably damaging Het
Chat C A 14: 32,145,269 (GRCm39) C380F possibly damaging Het
Cltc T C 11: 86,648,087 (GRCm39) Q10R probably benign Het
Cripto C T 9: 110,769,781 (GRCm39) M169I probably benign Het
Cst8 T C 2: 148,646,622 (GRCm39) probably benign Het
Cts3 C T 13: 61,715,868 (GRCm39) probably null Het
Cyp4a29 T A 4: 115,105,707 (GRCm39) D136E probably benign Het
Dmxl2 A C 9: 54,286,297 (GRCm39) probably null Het
Dsg4 T A 18: 20,584,919 (GRCm39) V211E possibly damaging Het
Efcab5 C T 11: 77,008,656 (GRCm39) V957I probably damaging Het
Eif4g2 A T 7: 110,673,358 (GRCm39) L807Q possibly damaging Het
Epha4 A G 1: 77,366,731 (GRCm39) probably benign Het
Epm2aip1 A T 9: 111,101,458 (GRCm39) I144F probably benign Het
Erbb4 C T 1: 68,599,735 (GRCm39) R114H probably damaging Het
Fabp3 C T 4: 130,206,180 (GRCm39) T57I probably benign Het
Fam170a C T 18: 50,415,038 (GRCm39) A228V probably damaging Het
Foxred1 A T 9: 35,117,571 (GRCm39) M254K possibly damaging Het
Gm1527 T A 3: 28,952,969 (GRCm39) C90S probably benign Het
Gpr137b T C 13: 13,533,947 (GRCm39) T370A probably benign Het
Gtf2e2 A G 8: 34,245,993 (GRCm39) probably benign Het
Hgsnat A T 8: 26,445,817 (GRCm39) L359* probably null Het
Hhip A T 8: 80,719,223 (GRCm39) C435S probably damaging Het
Hoxa13 T C 6: 52,236,107 (GRCm39) D310G possibly damaging Het
Hspa14 T C 2: 3,513,675 (GRCm39) Y18C probably damaging Het
Ighg1 A G 12: 113,293,270 (GRCm39) V140A probably damaging Het
Ighv1-58 A T 12: 115,275,930 (GRCm39) Y69* probably null Het
Inpp5j A G 11: 3,450,185 (GRCm39) F615L probably benign Het
Kcna1 T A 6: 126,619,873 (GRCm39) Y149F probably benign Het
Kcnj6 A T 16: 94,625,877 (GRCm39) probably null Het
Krtap4-1 G T 11: 99,518,637 (GRCm39) C124* probably null Het
Lama1 T A 17: 68,119,368 (GRCm39) L2615* probably null Het
Lcp2 A T 11: 34,018,439 (GRCm39) I72F probably damaging Het
Med1 T A 11: 98,062,532 (GRCm39) I189F possibly damaging Het
Meioc C T 11: 102,566,654 (GRCm39) R757C probably damaging Het
Mtr T A 13: 12,204,283 (GRCm39) H1171L probably damaging Het
Mtr G C 13: 12,204,284 (GRCm39) H1171D probably damaging Het
Naa12 A G 18: 80,255,339 (GRCm39) D211G probably benign Het
Nlrc5 A G 8: 95,202,620 (GRCm39) Y240C possibly damaging Het
Nsun4 T A 4: 115,908,259 (GRCm39) H767L possibly damaging Het
Pcdha1 T A 18: 37,064,189 (GRCm39) N284K probably benign Het
Pcdhgb8 A C 18: 37,896,414 (GRCm39) S495R probably benign Het
Pramel1 T A 4: 143,123,260 (GRCm39) I79N possibly damaging Het
Prdm6 A T 18: 53,673,390 (GRCm39) E183D possibly damaging Het
Prex2 T C 1: 11,254,740 (GRCm39) F1125L probably benign Het
Prkg2 T C 5: 99,127,674 (GRCm39) I346V possibly damaging Het
Ptprz1 A G 6: 23,002,584 (GRCm39) D1558G probably damaging Het
Pttg1ip2 A C 5: 5,528,955 (GRCm39) L20R probably damaging Het
Qng1 T A 13: 58,529,800 (GRCm39) K271* probably null Het
Rab11fip3 GCTCGTCT GCT 17: 26,287,002 (GRCm39) probably null Het
Rin2 C T 2: 145,702,366 (GRCm39) T354I probably benign Het
S100a6 A G 3: 90,521,508 (GRCm39) D50G probably damaging Het
Shroom3 T A 5: 93,096,342 (GRCm39) probably benign Het
Sipa1l1 G A 12: 82,388,556 (GRCm39) V261M possibly damaging Het
Slc5a4b T A 10: 75,910,826 (GRCm39) I337F probably damaging Het
Smarcc1 A G 9: 109,961,273 (GRCm39) Y30C possibly damaging Het
Swap70 A G 7: 109,880,512 (GRCm39) K576E possibly damaging Het
Syt6 A G 3: 103,532,809 (GRCm39) probably benign Het
Szt2 T C 4: 118,241,097 (GRCm39) I1726V probably benign Het
Thoc1 A G 18: 9,987,651 (GRCm39) K453E possibly damaging Het
Tmem38b A G 4: 53,854,409 (GRCm39) I214V probably benign Het
Tonsl A T 15: 76,521,244 (GRCm39) I354N probably damaging Het
Trappc9 T C 15: 72,903,472 (GRCm39) I303V possibly damaging Het
Trim66 A G 7: 109,057,338 (GRCm39) S1032P probably damaging Het
Tsc22d4 T C 5: 137,756,590 (GRCm39) V6A probably benign Het
Ubtd2 A G 11: 32,449,260 (GRCm39) K36E probably benign Het
Zkscan2 T C 7: 123,097,883 (GRCm39) E171G possibly damaging Het
Other mutations in Ccdc88b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01347:Ccdc88b APN 19 6,822,454 (GRCm39) missense probably damaging 1.00
IGL01637:Ccdc88b APN 19 6,824,078 (GRCm39) missense probably benign 0.13
IGL02201:Ccdc88b APN 19 6,823,999 (GRCm39) missense probably damaging 1.00
IGL02260:Ccdc88b APN 19 6,832,717 (GRCm39) splice site probably benign
IGL02276:Ccdc88b APN 19 6,833,475 (GRCm39) critical splice donor site probably null
IGL02412:Ccdc88b APN 19 6,824,012 (GRCm39) missense probably damaging 1.00
IGL02420:Ccdc88b APN 19 6,834,317 (GRCm39) missense probably damaging 1.00
IGL02990:Ccdc88b APN 19 6,824,777 (GRCm39) missense probably damaging 1.00
R0031:Ccdc88b UTSW 19 6,831,151 (GRCm39) missense possibly damaging 0.93
R0544:Ccdc88b UTSW 19 6,834,634 (GRCm39) missense probably damaging 1.00
R0727:Ccdc88b UTSW 19 6,831,582 (GRCm39) missense probably benign
R0920:Ccdc88b UTSW 19 6,824,017 (GRCm39) missense probably benign
R0975:Ccdc88b UTSW 19 6,823,993 (GRCm39) missense probably damaging 1.00
R1170:Ccdc88b UTSW 19 6,830,581 (GRCm39) missense probably damaging 1.00
R1363:Ccdc88b UTSW 19 6,827,739 (GRCm39) missense possibly damaging 0.55
R1471:Ccdc88b UTSW 19 6,831,391 (GRCm39) missense probably benign
R1605:Ccdc88b UTSW 19 6,827,837 (GRCm39) missense probably benign 0.06
R1752:Ccdc88b UTSW 19 6,830,690 (GRCm39) missense probably benign 0.02
R1832:Ccdc88b UTSW 19 6,830,900 (GRCm39) nonsense probably null
R1839:Ccdc88b UTSW 19 6,831,477 (GRCm39) splice site probably benign
R1917:Ccdc88b UTSW 19 6,826,594 (GRCm39) missense probably damaging 1.00
R2167:Ccdc88b UTSW 19 6,831,452 (GRCm39) missense possibly damaging 0.52
R4350:Ccdc88b UTSW 19 6,827,640 (GRCm39) missense probably damaging 0.97
R4427:Ccdc88b UTSW 19 6,827,940 (GRCm39) missense probably damaging 0.99
R4676:Ccdc88b UTSW 19 6,830,368 (GRCm39) missense probably benign 0.00
R4677:Ccdc88b UTSW 19 6,825,636 (GRCm39) missense probably damaging 0.98
R4720:Ccdc88b UTSW 19 6,835,083 (GRCm39) missense probably damaging 1.00
R4725:Ccdc88b UTSW 19 6,834,481 (GRCm39) missense probably damaging 1.00
R4747:Ccdc88b UTSW 19 6,833,509 (GRCm39) missense probably damaging 1.00
R5092:Ccdc88b UTSW 19 6,825,600 (GRCm39) missense probably damaging 0.99
R5403:Ccdc88b UTSW 19 6,835,108 (GRCm39) missense unknown
R5448:Ccdc88b UTSW 19 6,831,948 (GRCm39) missense probably damaging 1.00
R5771:Ccdc88b UTSW 19 6,831,203 (GRCm39) missense probably benign
R5783:Ccdc88b UTSW 19 6,831,284 (GRCm39) missense probably benign 0.19
R5988:Ccdc88b UTSW 19 6,833,348 (GRCm39) missense probably damaging 1.00
R6328:Ccdc88b UTSW 19 6,826,406 (GRCm39) missense probably damaging 1.00
R6459:Ccdc88b UTSW 19 6,832,246 (GRCm39) missense possibly damaging 0.92
R6773:Ccdc88b UTSW 19 6,826,409 (GRCm39) missense possibly damaging 0.71
R7073:Ccdc88b UTSW 19 6,831,330 (GRCm39) missense probably benign 0.34
R7707:Ccdc88b UTSW 19 6,834,837 (GRCm39) missense probably benign 0.23
R7810:Ccdc88b UTSW 19 6,826,454 (GRCm39) missense probably benign
R8298:Ccdc88b UTSW 19 6,827,649 (GRCm39) missense probably damaging 0.97
R8349:Ccdc88b UTSW 19 6,833,213 (GRCm39) missense probably damaging 1.00
R8449:Ccdc88b UTSW 19 6,833,213 (GRCm39) missense probably damaging 1.00
R8481:Ccdc88b UTSW 19 6,831,900 (GRCm39) missense probably damaging 1.00
R8506:Ccdc88b UTSW 19 6,824,690 (GRCm39) missense probably damaging 0.99
R8714:Ccdc88b UTSW 19 6,833,213 (GRCm39) missense probably damaging 1.00
R8715:Ccdc88b UTSW 19 6,833,213 (GRCm39) missense probably damaging 1.00
R8717:Ccdc88b UTSW 19 6,833,213 (GRCm39) missense probably damaging 1.00
R8753:Ccdc88b UTSW 19 6,833,213 (GRCm39) missense probably damaging 1.00
R8754:Ccdc88b UTSW 19 6,833,213 (GRCm39) missense probably damaging 1.00
R8774:Ccdc88b UTSW 19 6,825,090 (GRCm39) missense probably damaging 1.00
R8774-TAIL:Ccdc88b UTSW 19 6,825,090 (GRCm39) missense probably damaging 1.00
R8787:Ccdc88b UTSW 19 6,824,791 (GRCm39) missense probably damaging 1.00
R8896:Ccdc88b UTSW 19 6,831,203 (GRCm39) missense probably benign
R9049:Ccdc88b UTSW 19 6,826,442 (GRCm39) missense probably benign 0.37
R9100:Ccdc88b UTSW 19 6,833,213 (GRCm39) missense probably damaging 1.00
R9113:Ccdc88b UTSW 19 6,833,213 (GRCm39) missense probably damaging 1.00
R9197:Ccdc88b UTSW 19 6,833,213 (GRCm39) missense probably damaging 1.00
R9198:Ccdc88b UTSW 19 6,833,213 (GRCm39) missense probably damaging 1.00
R9198:Ccdc88b UTSW 19 6,831,268 (GRCm39) missense possibly damaging 0.92
R9202:Ccdc88b UTSW 19 6,833,213 (GRCm39) missense probably damaging 1.00
R9323:Ccdc88b UTSW 19 6,826,475 (GRCm39) missense probably damaging 1.00
R9334:Ccdc88b UTSW 19 6,833,541 (GRCm39) missense possibly damaging 0.50
R9385:Ccdc88b UTSW 19 6,833,533 (GRCm39) missense probably benign 0.13
R9441:Ccdc88b UTSW 19 6,833,213 (GRCm39) missense probably damaging 1.00
R9442:Ccdc88b UTSW 19 6,833,213 (GRCm39) missense probably damaging 1.00
R9748:Ccdc88b UTSW 19 6,831,461 (GRCm39) missense probably damaging 1.00
R9766:Ccdc88b UTSW 19 6,833,096 (GRCm39) missense probably damaging 1.00
X0021:Ccdc88b UTSW 19 6,831,199 (GRCm39) missense probably benign
Z1176:Ccdc88b UTSW 19 6,827,108 (GRCm39) missense possibly damaging 0.83
Predicted Primers PCR Primer
(F):5'- AAGTCTGACACCTCCTAAGCATG -3'
(R):5'- TCAGGAGCTGCATAGGAAGC -3'

Sequencing Primer
(F):5'- TGACACCTCCTAAGCATGAGCAC -3'
(R):5'- CTGCATAGGAAGCTGGGGGTG -3'
Posted On 2015-04-29