Mutagenetix > Incidental Mutation

Incidental Mutation 'R4013:Cfap57'

311808

Institutional Source

Beutler Lab

Gene Symbol

Cfap57

Ensembl Gene

ENSMUSG00000028730

Gene Name

cilia and flagella associated protein 57

Synonyms

Wdr65, 1110020C03Rik, C130004B06Rik, LOC384050

MMRRC Submission

040950-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R4013 (G1)

Quality Score

213

Status

Validated

Chromosome

Chromosomal Location

118554551-118620777 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 118593143 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Valine to Alanine at position 594 (V594A)

Ref Sequence

ENSEMBL: ENSMUSP00000080592 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000071972] [ENSMUST00000081921]

AlphaFold

Q9D180

Predicted Effect

probably benign
Transcript: ENSMUST00000071972
AA Change: V594A

PolyPhen 2 Score 0.012 (Sensitivity: 0.96; Specificity: 0.78)

SMART Domains

Protein: ENSMUSP00000071863
Gene: ENSMUSG00000028730
AA Change: V594A

Domain	Start	End	E-Value	Type
Blast:WD40	44	88	3e-12	BLAST
Blast:WD40	95	137	1e-9	BLAST
WD40	140	181	1.77e2	SMART
internal_repeat_1	182	237	7.23e-5	PROSPERO
WD40	329	365	1.27e2	SMART
WD40	376	416	3.4e-2	SMART
WD40	418	456	1.59e1	SMART
Blast:WD40	461	497	4e-18	BLAST
WD40	500	539	9.67e-7	SMART
WD40	544	581	3.96e1	SMART
Blast:WD40	582	621	8e-16	BLAST
WD40	626	665	3.21e-1	SMART
coiled coil region	690	1056	N/A	INTRINSIC
coiled coil region	1094	1166	N/A	INTRINSIC
coiled coil region	1197	1222	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000081921
AA Change: V594A

PolyPhen 2 Score 0.012 (Sensitivity: 0.96; Specificity: 0.78)

SMART Domains

Protein: ENSMUSP00000080592
Gene: ENSMUSG00000028730
AA Change: V594A

Domain	Start	End	E-Value	Type
Blast:WD40	44	88	3e-12	BLAST
Blast:WD40	95	137	1e-9	BLAST
WD40	140	181	1.77e2	SMART
internal_repeat_1	182	237	7.23e-5	PROSPERO
WD40	329	365	1.27e2	SMART
WD40	376	416	3.4e-2	SMART
WD40	418	456	1.59e1	SMART
Blast:WD40	461	497	4e-18	BLAST
WD40	500	539	9.67e-7	SMART
WD40	544	581	3.96e1	SMART
Blast:WD40	582	621	8e-16	BLAST
WD40	626	665	3.21e-1	SMART
coiled coil region	690	1056	N/A	INTRINSIC
coiled coil region	1094	1166	N/A	INTRINSIC
coiled coil region	1197	1222	N/A	INTRINSIC

Meta Mutation Damage Score

0.0939

Coding Region Coverage

1x: 99.2%
3x: 98.4%
10x: 96.6%
20x: 92.4%

Validation Efficiency

98% (47/48)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This protein encoded by this gene belongs to the WD repeat-containing family of proteins, which function in the formation of protein-protein complexes in a variety of biological pathways. This family member is thought to function in craniofacial development, possibly in the fusion of lip and palate. A missense mutation in this gene is associated with Van der Woude syndrome 2. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, Aug 2011]

Allele List at MGI

Other mutations in this stock

Total: 43 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abcc6	T	C	7: 46,018,680	Q168R	probably benign	Het
Adgrg3	A	G	8: 95,035,099		probably benign	Het
Apold1	A	G	6: 134,983,906	I108V	probably benign	Het
Atp6v0a2	G	A	5: 124,712,796	V429M	probably damaging	Het
Cbln4	A	T	2: 172,037,557	M137K	probably damaging	Het
Chd9	A	G	8: 90,973,169	E28G	possibly damaging	Het
Clip4	T	A	17: 71,856,546	C704*	probably null	Het
Col8a2	T	A	4: 126,311,115		probably benign	Het
Cyp3a59	A	G	5: 146,079,383	T17A	probably benign	Het
Cyp4f14	G	A	17: 32,916,879	Q3*	probably null	Het
Cysltr2	A	G	14: 73,029,565	I235T	probably damaging	Het
Esp34	C	A	17: 38,559,555	C45*	probably null	Het
Gabrg2	T	C	11: 41,971,880	K126E	possibly damaging	Het
Gm4846	A	C	1: 166,494,680		probably null	Het
Igsf21	T	C	4: 140,037,469	N165S	possibly damaging	Het
Kcnf1	A	G	12: 17,175,993	F76L	probably benign	Het
Kcns1	A	G	2: 164,168,257	V194A	probably damaging	Het
Kdm5a	T	A	6: 120,394,106	Y504N	probably damaging	Het
Kdm5b	A	G	1: 134,627,329	Y1325C	possibly damaging	Het
Kif1a	T	C	1: 93,076,292	D156G	probably damaging	Het
Lrp1b	A	G	2: 40,802,984	F3401L	possibly damaging	Het
Lrrc63	A	G	14: 75,098,291	Y460H	probably damaging	Het
Myo15b	G	T	11: 115,871,456	E1201*	probably null	Het
Ndor1	A	T	2: 25,250,150	I84K	probably damaging	Het
Ndst4	T	A	3: 125,683,170	Y15N	probably damaging	Het
Olfr1019	A	G	2: 85,841,381	S137P	probably damaging	Het
Olfr609	T	C	7: 103,492,633	T82A	probably benign	Het
Pik3r6	T	A	11: 68,533,521	D317E	possibly damaging	Het
Ppp2r1a	G	A	17: 20,951,347	R28H	probably damaging	Het
Ptch1	T	G	13: 63,524,959	E944A	probably benign	Het
Ptpn12	G	A	5: 20,992,743	P700L	probably benign	Het
Setx	GTGGCT	GT	2: 29,154,061	1814	probably null	Het
Slc39a13	T	C	2: 91,064,902		probably null	Het
Smarca2	G	A	19: 26,683,927		probably null	Het
Taok1	A	T	11: 77,559,833	L371H	possibly damaging	Het
Tas2r116	A	G	6: 132,856,267	H277R	probably damaging	Het
Treml4	G	A	17: 48,264,809	R80Q	probably benign	Het
Trim9	G	A	12: 70,346,352	H273Y	probably damaging	Het
Tyr	A	G	7: 87,437,940	S455P	probably benign	Het
Vmn1r214	G	A	13: 23,035,350	C338Y	probably benign	Het
Vmn2r52	G	A	7: 10,170,676	T412I	probably benign	Het
Wdr70	A	T	15: 8,079,214	C149*	probably null	Het
Wdr93	T	A	7: 79,768,411	V294E	possibly damaging	Het

Other mutations in Cfap57

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00502:Cfap57	APN	4	118581001	missense	probably benign	0.01
IGL00508:Cfap57	APN	4	118581170	splice site	probably null
IGL00857:Cfap57	APN	4	118612923	critical splice donor site	probably null
IGL01147:Cfap57	APN	4	118589001	missense	probably damaging	0.97
IGL01396:Cfap57	APN	4	118610595	missense	probably damaging	1.00
IGL01420:Cfap57	APN	4	118612940	missense	probably benign	0.21
IGL01615:Cfap57	APN	4	118600796	missense	probably damaging	1.00
IGL02154:Cfap57	APN	4	118613017	missense	probably damaging	1.00
IGL02161:Cfap57	APN	4	118579372	missense	possibly damaging	0.75
IGL02481:Cfap57	APN	4	118581105	missense	probably damaging	1.00
IGL02483:Cfap57	APN	4	118581105	missense	probably damaging	1.00
IGL02503:Cfap57	APN	4	118569348	critical splice donor site	probably null
IGL02800:Cfap57	APN	4	118614750	missense	probably damaging	1.00
IGL03083:Cfap57	APN	4	118584739	missense	probably damaging	0.96
IGL03146:Cfap57	APN	4	118599019	missense	probably damaging	1.00
IGL03246:Cfap57	APN	4	118576645	missense	probably benign	0.29
IGL03376:Cfap57	APN	4	118584720	missense	probably damaging	0.96
G1Funyon:Cfap57	UTSW	4	118593074	missense	possibly damaging	0.94
R0144:Cfap57	UTSW	4	118584705	missense	probably damaging	1.00
R0184:Cfap57	UTSW	4	118599012	missense	probably damaging	1.00
R0415:Cfap57	UTSW	4	118569431	missense	possibly damaging	0.89
R0515:Cfap57	UTSW	4	118620402	missense	probably damaging	1.00
R0690:Cfap57	UTSW	4	118569727	splice site	probably benign
R0730:Cfap57	UTSW	4	118612920	splice site	probably null
R0737:Cfap57	UTSW	4	118581102	missense	possibly damaging	0.81
R0854:Cfap57	UTSW	4	118561872	missense	probably benign	0.04
R0880:Cfap57	UTSW	4	118581838	nonsense	probably null
R1085:Cfap57	UTSW	4	118595779	missense	probably benign	0.20
R1119:Cfap57	UTSW	4	118606676	nonsense	probably null
R1217:Cfap57	UTSW	4	118606652	missense	possibly damaging	0.67
R1294:Cfap57	UTSW	4	118606534	critical splice donor site	probably null
R1487:Cfap57	UTSW	4	118614781	missense	probably benign	0.01
R1676:Cfap57	UTSW	4	118595940	missense	probably damaging	1.00
R1688:Cfap57	UTSW	4	118569646	missense	probably null	0.20
R1709:Cfap57	UTSW	4	118571704	missense	probably benign	0.00
R1719:Cfap57	UTSW	4	118606631	missense	probably benign	0.04
R1782:Cfap57	UTSW	4	118614975	missense	probably damaging	0.98
R1791:Cfap57	UTSW	4	118571724	missense	possibly damaging	0.66
R1850:Cfap57	UTSW	4	118599894	missense	probably damaging	1.00
R1866:Cfap57	UTSW	4	118599927	missense	possibly damaging	0.49
R1912:Cfap57	UTSW	4	118615010	missense	probably damaging	0.96
R1978:Cfap57	UTSW	4	118593132	missense	probably benign	0.03
R2177:Cfap57	UTSW	4	118606688	missense	probably benign	0.00
R2322:Cfap57	UTSW	4	118610725	missense	probably benign
R3905:Cfap57	UTSW	4	118595839	missense	probably damaging	1.00
R4079:Cfap57	UTSW	4	118598997	missense	probably benign	0.34
R4962:Cfap57	UTSW	4	118613065	missense	probably benign	0.21
R4970:Cfap57	UTSW	4	118620371	missense	probably damaging	0.99
R4974:Cfap57	UTSW	4	118593054	missense	probably damaging	1.00
R4999:Cfap57	UTSW	4	118595848	missense	probably benign	0.01
R5482:Cfap57	UTSW	4	118569641	missense	probably benign
R5522:Cfap57	UTSW	4	118595888	missense	probably benign	0.41
R5626:Cfap57	UTSW	4	118614783	missense	probably damaging	1.00
R5685:Cfap57	UTSW	4	118569459	missense	probably benign
R5712:Cfap57	UTSW	4	118614795	missense	probably damaging	1.00
R5961:Cfap57	UTSW	4	118571745	missense	probably benign	0.00
R6244:Cfap57	UTSW	4	118579410	missense	probably damaging	0.99
R6268:Cfap57	UTSW	4	118569451	nonsense	probably null
R6271:Cfap57	UTSW	4	118595759	missense	probably benign	0.13
R6330:Cfap57	UTSW	4	118569396	missense	probably benign
R6439:Cfap57	UTSW	4	118588975	critical splice donor site	probably null
R6639:Cfap57	UTSW	4	118554712	missense	probably benign	0.13
R6722:Cfap57	UTSW	4	118584717	missense	probably damaging	1.00
R7033:Cfap57	UTSW	4	118613126	missense	possibly damaging	0.67
R7143:Cfap57	UTSW	4	118620709	unclassified	probably benign
R7162:Cfap57	UTSW	4	118614931	missense	probably benign
R7174:Cfap57	UTSW	4	118589067	missense	probably benign	0.35
R7210:Cfap57	UTSW	4	118576703	nonsense	probably null
R7242:Cfap57	UTSW	4	118593096	missense	possibly damaging	0.50
R7244:Cfap57	UTSW	4	118554800	nonsense	probably null
R7359:Cfap57	UTSW	4	118598965	missense	probably benign	0.01
R7373:Cfap57	UTSW	4	118614931	missense	probably benign
R7394:Cfap57	UTSW	4	118593137	missense	probably benign	0.00
R7401:Cfap57	UTSW	4	118614931	missense	probably benign
R7412:Cfap57	UTSW	4	118614931	missense	probably benign
R7414:Cfap57	UTSW	4	118614931	missense	probably benign
R7452:Cfap57	UTSW	4	118595784	missense	probably damaging	1.00
R7457:Cfap57	UTSW	4	118589001	missense	probably damaging	0.97
R7559:Cfap57	UTSW	4	118614931	missense	probably benign
R7642:Cfap57	UTSW	4	118614931	missense	probably benign
R7741:Cfap57	UTSW	4	118614931	missense	probably benign
R7744:Cfap57	UTSW	4	118614931	missense	probably benign
R7745:Cfap57	UTSW	4	118614931	missense	probably benign
R7842:Cfap57	UTSW	4	118554755	nonsense	probably null
R7936:Cfap57	UTSW	4	118614931	missense	probably benign
R7940:Cfap57	UTSW	4	118614931	missense	probably benign
R7942:Cfap57	UTSW	4	118614931	missense	probably benign
R8074:Cfap57	UTSW	4	118569625	missense	possibly damaging	0.66
R8301:Cfap57	UTSW	4	118593074	missense	possibly damaging	0.94
R8411:Cfap57	UTSW	4	118614931	missense	probably benign
R8447:Cfap57	UTSW	4	118614931	missense	probably benign
R8491:Cfap57	UTSW	4	118614931	missense	probably benign
R8524:Cfap57	UTSW	4	118614931	missense	probably benign
R8670:Cfap57	UTSW	4	118614925	missense	possibly damaging	0.91
R8707:Cfap57	UTSW	4	118593006	missense	probably benign	0.04
R8790:Cfap57	UTSW	4	118581914	missense	possibly damaging	0.59
R8941:Cfap57	UTSW	4	118569602	missense	probably damaging	0.99
R9139:Cfap57	UTSW	4	118554851	missense	probably benign	0.02
R9212:Cfap57	UTSW	4	118579452	missense	possibly damaging	0.95
R9442:Cfap57	UTSW	4	118606534	critical splice donor site	probably null
R9525:Cfap57	UTSW	4	118576581	missense	probably damaging	1.00
X0022:Cfap57	UTSW	4	118614745	missense	probably benign
Z1088:Cfap57	UTSW	4	118581882	missense	probably benign	0.22
Z1177:Cfap57	UTSW	4	118598956	critical splice donor site	probably null

Predicted Primers

PCR Primer
(F):5'- TATGACTAGCCAGCAGGTGC -3'
(R):5'- TTAGGCCTTTCACATGCGGC -3'

Sequencing Primer
(F):5'- GCAACACAGAAACTGCTGG -3'
(R):5'- GCGGCTACTATACCAAATACTATAAG -3'

Posted On

2015-04-29