Mutagenetix > Incidental Mutation

Incidental Mutation 'R4013:Atp6v0a2'

311812

Institutional Source

Beutler Lab

Gene Symbol

Atp6v0a2

Ensembl Gene

ENSMUSG00000038023

Gene Name

ATPase, H+ transporting, lysosomal V0 subunit A2

Synonyms

V-ATPase a2, Atp6n2, 8430408C20Rik, Tj6, ATP6a2, TJ6s

MMRRC Submission

040950-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.146) question?

Stock #

R4013 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

124628576-124724455 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 124712796 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Valine to Methionine at position 429 (V429M)

Ref Sequence

ENSEMBL: ENSMUSP00000039737 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000037865] [ENSMUST00000198382]

AlphaFold

P15920

PDB Structure

NMR solution structure of peptide a2N(1-17) from Mus musculus V-ATPase [SOLUTION NMR]

Predicted Effect

probably damaging
Transcript: ENSMUST00000037865
AA Change: V429M

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)

SMART Domains

Protein: ENSMUSP00000039737
Gene: ENSMUSG00000038023
AA Change: V429M

Domain	Start	End	E-Value	Type
Pfam:V_ATPase_I	27	842	3.3e-299	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000158025

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000197087

Predicted Effect

probably benign
Transcript: ENSMUST00000198382

SMART Domains

Protein: ENSMUSP00000143284
Gene: ENSMUSG00000038023

Domain	Start	End	E-Value	Type
signal peptide	1	22	N/A	INTRINSIC
Pfam:V_ATPase_I	26	178	1.5e-36	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000199526

Meta Mutation Damage Score

0.5301

Coding Region Coverage

1x: 99.2%
3x: 98.4%
10x: 96.6%
20x: 92.4%

Validation Efficiency

98% (47/48)

MGI Phenotype

FUNCTION: This gene encodes a subunit of vacuolar ATPase, a multimeric enzyme that localizes to intracellular vesicles and to the plasma membrane of specialized cells. The encoded protein is a component of the V(0) domain, which functions in proton translocation across membranes. Function of this gene is important in fetal-specific immune suppression during pregnancy. [provided by RefSeq, May 2013]

Allele List at MGI

Other mutations in this stock

Total: 43 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abcc6	T	C	7: 46,018,680	Q168R	probably benign	Het
Adgrg3	A	G	8: 95,035,099		probably benign	Het
Apold1	A	G	6: 134,983,906	I108V	probably benign	Het
Cbln4	A	T	2: 172,037,557	M137K	probably damaging	Het
Cfap57	A	G	4: 118,593,143	V594A	probably benign	Het
Chd9	A	G	8: 90,973,169	E28G	possibly damaging	Het
Clip4	T	A	17: 71,856,546	C704*	probably null	Het
Col8a2	T	A	4: 126,311,115		probably benign	Het
Cyp3a59	A	G	5: 146,079,383	T17A	probably benign	Het
Cyp4f14	G	A	17: 32,916,879	Q3*	probably null	Het
Cysltr2	A	G	14: 73,029,565	I235T	probably damaging	Het
Esp34	C	A	17: 38,559,555	C45*	probably null	Het
Gabrg2	T	C	11: 41,971,880	K126E	possibly damaging	Het
Gm4846	A	C	1: 166,494,680		probably null	Het
Igsf21	T	C	4: 140,037,469	N165S	possibly damaging	Het
Kcnf1	A	G	12: 17,175,993	F76L	probably benign	Het
Kcns1	A	G	2: 164,168,257	V194A	probably damaging	Het
Kdm5a	T	A	6: 120,394,106	Y504N	probably damaging	Het
Kdm5b	A	G	1: 134,627,329	Y1325C	possibly damaging	Het
Kif1a	T	C	1: 93,076,292	D156G	probably damaging	Het
Lrp1b	A	G	2: 40,802,984	F3401L	possibly damaging	Het
Lrrc63	A	G	14: 75,098,291	Y460H	probably damaging	Het
Myo15b	G	T	11: 115,871,456	E1201*	probably null	Het
Ndor1	A	T	2: 25,250,150	I84K	probably damaging	Het
Ndst4	T	A	3: 125,683,170	Y15N	probably damaging	Het
Olfr1019	A	G	2: 85,841,381	S137P	probably damaging	Het
Olfr609	T	C	7: 103,492,633	T82A	probably benign	Het
Pik3r6	T	A	11: 68,533,521	D317E	possibly damaging	Het
Ppp2r1a	G	A	17: 20,951,347	R28H	probably damaging	Het
Ptch1	T	G	13: 63,524,959	E944A	probably benign	Het
Ptpn12	G	A	5: 20,992,743	P700L	probably benign	Het
Setx	GTGGCT	GT	2: 29,154,061	1814	probably null	Het
Slc39a13	T	C	2: 91,064,902		probably null	Het
Smarca2	G	A	19: 26,683,927		probably null	Het
Taok1	A	T	11: 77,559,833	L371H	possibly damaging	Het
Tas2r116	A	G	6: 132,856,267	H277R	probably damaging	Het
Treml4	G	A	17: 48,264,809	R80Q	probably benign	Het
Trim9	G	A	12: 70,346,352	H273Y	probably damaging	Het
Tyr	A	G	7: 87,437,940	S455P	probably benign	Het
Vmn1r214	G	A	13: 23,035,350	C338Y	probably benign	Het
Vmn2r52	G	A	7: 10,170,676	T412I	probably benign	Het
Wdr70	A	T	15: 8,079,214	C149*	probably null	Het
Wdr93	T	A	7: 79,768,411	V294E	possibly damaging	Het

Other mutations in Atp6v0a2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00089:Atp6v0a2	APN	5	124721777	missense	probably benign	0.19
IGL01310:Atp6v0a2	APN	5	124646028	missense	probably damaging	1.00
IGL01944:Atp6v0a2	APN	5	124636105	missense	probably benign	0.04
IGL02044:Atp6v0a2	APN	5	124646014	missense	probably benign	0.00
IGL02400:Atp6v0a2	APN	5	124721785	missense	probably benign
IGL02650:Atp6v0a2	APN	5	124712362	splice site	probably benign
IGL02687:Atp6v0a2	APN	5	124714142	missense	possibly damaging	0.67
IGL02965:Atp6v0a2	APN	5	124629202	missense	possibly damaging	0.85
IGL03049:Atp6v0a2	APN	5	124712781	missense	probably damaging	1.00
IGL03088:Atp6v0a2	APN	5	124714107	splice site	probably benign
IGL03198:Atp6v0a2	APN	5	124712361	critical splice donor site	probably null
alkaline	UTSW	5	124719866	missense	probably damaging	1.00
basic	UTSW	5	124712328	nonsense	probably null
electronegative	UTSW	5	124646698	missense	probably damaging	1.00
energizer	UTSW	5	124719986	missense	probably damaging	0.98
Everready	UTSW	5	124641505	missense	probably damaging	0.99
Lithium	UTSW	5	124714145	missense	probably damaging	1.00
R0128:Atp6v0a2	UTSW	5	124713184	missense	probably damaging	1.00
R0594:Atp6v0a2	UTSW	5	124717982	missense	probably benign	0.01
R1540:Atp6v0a2	UTSW	5	124646698	missense	probably damaging	1.00
R2136:Atp6v0a2	UTSW	5	124718488	missense	possibly damaging	0.78
R2921:Atp6v0a2	UTSW	5	124717917	missense	possibly damaging	0.80
R2922:Atp6v0a2	UTSW	5	124717917	missense	possibly damaging	0.80
R2923:Atp6v0a2	UTSW	5	124717917	missense	possibly damaging	0.80
R3055:Atp6v0a2	UTSW	5	124627144	unclassified	probably benign
R3889:Atp6v0a2	UTSW	5	124639265	missense	probably damaging	1.00
R3893:Atp6v0a2	UTSW	5	124639265	missense	probably damaging	1.00
R4490:Atp6v0a2	UTSW	5	124646734	missense	probably damaging	1.00
R4791:Atp6v0a2	UTSW	5	124646727	missense	probably benign	0.17
R5219:Atp6v0a2	UTSW	5	124713185	missense	probably damaging	1.00
R5247:Atp6v0a2	UTSW	5	124713177	missense	probably damaging	1.00
R5293:Atp6v0a2	UTSW	5	124646709	missense	probably benign	0.00
R5620:Atp6v0a2	UTSW	5	124645969	nonsense	probably null
R5830:Atp6v0a2	UTSW	5	124641547	missense	probably damaging	1.00
R5875:Atp6v0a2	UTSW	5	124716327	missense	probably benign
R5903:Atp6v0a2	UTSW	5	124712279	missense	probably damaging	1.00
R6192:Atp6v0a2	UTSW	5	124629203	missense	probably benign	0.01
R6425:Atp6v0a2	UTSW	5	124713130	missense	probably damaging	1.00
R6752:Atp6v0a2	UTSW	5	124641514	missense	probably damaging	1.00
R6919:Atp6v0a2	UTSW	5	124712161	splice site	probably null
R6994:Atp6v0a2	UTSW	5	124714145	missense	probably damaging	1.00
R7053:Atp6v0a2	UTSW	5	124645983	missense	probably damaging	1.00
R7268:Atp6v0a2	UTSW	5	124719866	missense	probably damaging	1.00
R7342:Atp6v0a2	UTSW	5	124646736	missense	probably damaging	1.00
R7349:Atp6v0a2	UTSW	5	124712328	nonsense	probably null
R7714:Atp6v0a2	UTSW	5	124637595	missense	probably damaging	1.00
R7715:Atp6v0a2	UTSW	5	124714198	missense	probably damaging	0.99
R7748:Atp6v0a2	UTSW	5	124716496	missense	probably benign	0.00
R7775:Atp6v0a2	UTSW	5	124641505	missense	probably damaging	0.99
R7778:Atp6v0a2	UTSW	5	124641505	missense	probably damaging	0.99
R7824:Atp6v0a2	UTSW	5	124641505	missense	probably damaging	0.99
R7833:Atp6v0a2	UTSW	5	124645031	missense	probably damaging	1.00
R7901:Atp6v0a2	UTSW	5	124641547	missense	probably damaging	1.00
R7977:Atp6v0a2	UTSW	5	124719986	missense	probably damaging	0.98
R7987:Atp6v0a2	UTSW	5	124719986	missense	probably damaging	0.98
R8118:Atp6v0a2	UTSW	5	124712773	missense	probably damaging	0.98
R8728:Atp6v0a2	UTSW	5	124719088	missense	probably benign	0.00
R8765:Atp6v0a2	UTSW	5	124716470	missense	probably damaging	1.00
R8945:Atp6v0a2	UTSW	5	124646649	missense	probably damaging	1.00
R8971:Atp6v0a2	UTSW	5	124719997	missense	probably damaging	1.00
R9023:Atp6v0a2	UTSW	5	124719074	missense	possibly damaging	0.93
R9300:Atp6v0a2	UTSW	5	124712248	missense	probably damaging	0.98
R9360:Atp6v0a2	UTSW	5	124629194	missense	possibly damaging	0.77
R9601:Atp6v0a2	UTSW	5	124713193	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GCTTTGTGTAGCATTTAAATGGCC -3'
(R):5'- AACAAGTTTGAGTCCAGCAGG -3'

Sequencing Primer
(F):5'- GTCCTGTTCTGAGAGCTCTGAAAAAG -3'
(R):5'- AGGACTACCTGAGACCATCTC -3'

Posted On

2015-04-29