Incidental Mutation 'R4013:Cyp3a59'
ID311813
Institutional Source Beutler Lab
Gene Symbol Cyp3a59
Ensembl Gene ENSMUSG00000061292
Gene Namecytochrome P450, family 3, subfamily a, polypeptide 59
Synonyms
MMRRC Submission 040950-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4013 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location146079257-146113287 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 146079383 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 17 (T17A)
Ref Sequence ENSEMBL: ENSMUSP00000049494 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035571] [ENSMUST00000199212]
Predicted Effect probably benign
Transcript: ENSMUST00000035571
AA Change: T17A

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000049494
Gene: ENSMUSG00000061292
AA Change: T17A

DomainStartEndE-ValueType
Pfam:p450 38 493 5.3e-128 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000199212
AA Change: T17A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000142591
Gene: ENSMUSG00000061292
AA Change: T17A

DomainStartEndE-ValueType
signal peptide 1 29 N/A INTRINSIC
Pfam:p450 38 148 3.3e-20 PFAM
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.6%
  • 20x: 92.4%
Validation Efficiency 98% (47/48)
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc6 T C 7: 46,018,680 Q168R probably benign Het
Adgrg3 A G 8: 95,035,099 probably benign Het
Apold1 A G 6: 134,983,906 I108V probably benign Het
Atp6v0a2 G A 5: 124,712,796 V429M probably damaging Het
Cbln4 A T 2: 172,037,557 M137K probably damaging Het
Cfap57 A G 4: 118,593,143 V594A probably benign Het
Chd9 A G 8: 90,973,169 E28G possibly damaging Het
Clip4 T A 17: 71,856,546 C704* probably null Het
Col8a2 T A 4: 126,311,115 probably benign Het
Cyp4f14 G A 17: 32,916,879 Q3* probably null Het
Cysltr2 A G 14: 73,029,565 I235T probably damaging Het
Esp34 C A 17: 38,559,555 C45* probably null Het
Gabrg2 T C 11: 41,971,880 K126E possibly damaging Het
Gm4846 A C 1: 166,494,680 probably null Het
Igsf21 T C 4: 140,037,469 N165S possibly damaging Het
Kcnf1 A G 12: 17,175,993 F76L probably benign Het
Kcns1 A G 2: 164,168,257 V194A probably damaging Het
Kdm5a T A 6: 120,394,106 Y504N probably damaging Het
Kdm5b A G 1: 134,627,329 Y1325C possibly damaging Het
Kif1a T C 1: 93,076,292 D156G probably damaging Het
Lrp1b A G 2: 40,802,984 F3401L possibly damaging Het
Lrrc63 A G 14: 75,098,291 Y460H probably damaging Het
Myo15b G T 11: 115,871,456 E1201* probably null Het
Ndor1 A T 2: 25,250,150 I84K probably damaging Het
Ndst4 T A 3: 125,683,170 Y15N probably damaging Het
Olfr1019 A G 2: 85,841,381 S137P probably damaging Het
Olfr609 T C 7: 103,492,633 T82A probably benign Het
Pik3r6 T A 11: 68,533,521 D317E possibly damaging Het
Ppp2r1a G A 17: 20,951,347 R28H probably damaging Het
Ptch1 T G 13: 63,524,959 E944A probably benign Het
Ptpn12 G A 5: 20,992,743 P700L probably benign Het
Setx GTGGCT GT 2: 29,154,061 probably null Het
Slc39a13 T C 2: 91,064,902 probably null Het
Smarca2 G A 19: 26,683,927 probably null Het
Taok1 A T 11: 77,559,833 L371H possibly damaging Het
Tas2r116 A G 6: 132,856,267 H277R probably damaging Het
Treml4 G A 17: 48,264,809 R80Q probably benign Het
Trim9 G A 12: 70,346,352 H273Y probably damaging Het
Tyr A G 7: 87,437,940 S455P probably benign Het
Vmn1r214 G A 13: 23,035,350 C338Y probably benign Het
Vmn2r52 G A 7: 10,170,676 T412I probably benign Het
Wdr70 A T 15: 8,079,214 C149* probably null Het
Wdr93 T A 7: 79,768,411 V294E possibly damaging Het
Other mutations in Cyp3a59
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01120:Cyp3a59 APN 5 146102861 missense probably damaging 0.99
IGL01129:Cyp3a59 APN 5 146098279 missense probably benign 0.06
IGL01628:Cyp3a59 APN 5 146099819 missense possibly damaging 0.94
IGL01982:Cyp3a59 APN 5 146104735 missense probably benign 0.00
IGL02094:Cyp3a59 APN 5 146104821 missense probably benign 0.05
IGL02140:Cyp3a59 APN 5 146102880 missense probably damaging 1.00
IGL02350:Cyp3a59 APN 5 146079342 missense probably damaging 1.00
IGL02357:Cyp3a59 APN 5 146079342 missense probably damaging 1.00
IGL02445:Cyp3a59 APN 5 146096653 missense probably benign 0.00
IGL02681:Cyp3a59 APN 5 146090746 splice site probably benign
IGL02870:Cyp3a59 APN 5 146098184 missense probably benign
IGL03023:Cyp3a59 APN 5 146085850 missense probably benign 0.02
PIT4802001:Cyp3a59 UTSW 5 146102801 missense probably benign 0.00
R0220:Cyp3a59 UTSW 5 146098270 missense probably benign 0.02
R0532:Cyp3a59 UTSW 5 146096653 nonsense probably null
R1084:Cyp3a59 UTSW 5 146096674 missense probably benign
R1263:Cyp3a59 UTSW 5 146104711 missense probably damaging 1.00
R1573:Cyp3a59 UTSW 5 146102874 missense probably damaging 1.00
R1747:Cyp3a59 UTSW 5 146104758 missense probably benign
R1759:Cyp3a59 UTSW 5 146098250 missense probably benign 0.10
R1812:Cyp3a59 UTSW 5 146102811 missense probably damaging 1.00
R1937:Cyp3a59 UTSW 5 146094377 missense possibly damaging 0.80
R2026:Cyp3a59 UTSW 5 146096288 missense probably damaging 1.00
R2060:Cyp3a59 UTSW 5 146104714 missense probably damaging 1.00
R2355:Cyp3a59 UTSW 5 146099812 missense probably benign 0.09
R3721:Cyp3a59 UTSW 5 146096597 missense probably damaging 0.96
R4421:Cyp3a59 UTSW 5 146104903 splice site probably null
R4432:Cyp3a59 UTSW 5 146104786 missense probably benign 0.04
R4633:Cyp3a59 UTSW 5 146094438 missense probably damaging 1.00
R4843:Cyp3a59 UTSW 5 146096261 missense possibly damaging 0.61
R4886:Cyp3a59 UTSW 5 146087387 missense probably damaging 1.00
R5236:Cyp3a59 UTSW 5 146102825 missense probably benign 0.20
R5386:Cyp3a59 UTSW 5 146085768 missense probably benign 0.01
R5627:Cyp3a59 UTSW 5 146112854 missense probably benign 0.00
R5792:Cyp3a59 UTSW 5 146099851 missense possibly damaging 0.92
R5935:Cyp3a59 UTSW 5 146090645 nonsense probably null
R6531:Cyp3a59 UTSW 5 146098217 missense probably benign 0.00
R6790:Cyp3a59 UTSW 5 146096333 missense probably benign
R7108:Cyp3a59 UTSW 5 146096333 missense probably benign
R7222:Cyp3a59 UTSW 5 146096575 critical splice acceptor site probably null
R7447:Cyp3a59 UTSW 5 146087405 missense probably benign 0.25
R7457:Cyp3a59 UTSW 5 146104750 missense probably damaging 1.00
R7723:Cyp3a59 UTSW 5 146079344 missense probably benign 0.06
Z1088:Cyp3a59 UTSW 5 146098222 missense probably benign 0.33
Predicted Primers PCR Primer
(F):5'- CTACAAATTTGGGCAGTGTGC -3'
(R):5'- AAGCTCCTAGAATGGCCAGTG -3'

Sequencing Primer
(F):5'- CAAGTGGCCCTTGTACTGG -3'
(R):5'- AGCTCCTAGAATGGCCAGTGATATTG -3'
Posted On2015-04-29