Incidental Mutation 'R4013:Kdm5a'
ID311814
Institutional Source Beutler Lab
Gene Symbol Kdm5a
Ensembl Gene ENSMUSG00000030180
Gene Namelysine (K)-specific demethylase 5A
SynonymsJarid1a, Rbbp2, RBP2
MMRRC Submission 040950-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4013 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location120364124-120444574 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 120394106 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Asparagine at position 504 (Y504N)
Ref Sequence ENSEMBL: ENSMUSP00000145021 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000005108] [ENSMUST00000132009] [ENSMUST00000135802]
Predicted Effect probably damaging
Transcript: ENSMUST00000005108
AA Change: Y504N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000005108
Gene: ENSMUSG00000030180
AA Change: Y504N

DomainStartEndE-ValueType
JmjN 18 59 4.06e-20 SMART
ARID 81 170 4.76e-35 SMART
BRIGHT 85 175 2.48e-31 SMART
PHD 295 341 1.16e-14 SMART
Blast:JmjC 384 436 2e-22 BLAST
JmjC 437 603 5.88e-73 SMART
low complexity region 638 651 N/A INTRINSIC
Pfam:zf-C5HC2 676 729 1.3e-21 PFAM
Pfam:PLU-1 740 1072 1.2e-104 PFAM
low complexity region 1091 1119 N/A INTRINSIC
PHD 1163 1216 1.37e-11 SMART
low complexity region 1269 1280 N/A INTRINSIC
low complexity region 1337 1351 N/A INTRINSIC
low complexity region 1403 1414 N/A INTRINSIC
low complexity region 1494 1512 N/A INTRINSIC
coiled coil region 1534 1579 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000100996
AA Change: Y504N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000098558
Gene: ENSMUSG00000030180
AA Change: Y504N

DomainStartEndE-ValueType
JmjN 18 59 4.06e-20 SMART
ARID 81 170 4.76e-35 SMART
BRIGHT 85 175 2.48e-31 SMART
PHD 295 341 1.16e-14 SMART
Blast:JmjC 384 436 2e-22 BLAST
JmjC 437 603 5.88e-73 SMART
low complexity region 638 651 N/A INTRINSIC
Pfam:zf-C5HC2 676 728 3.6e-17 PFAM
Pfam:PLU-1 741 1072 5e-104 PFAM
low complexity region 1091 1119 N/A INTRINSIC
PHD 1163 1216 1.37e-11 SMART
low complexity region 1269 1280 N/A INTRINSIC
low complexity region 1337 1351 N/A INTRINSIC
low complexity region 1403 1414 N/A INTRINSIC
low complexity region 1494 1512 N/A INTRINSIC
coiled coil region 1534 1579 N/A INTRINSIC
PHD 1614 1659 1.27e-6 SMART
low complexity region 1662 1674 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000132009
AA Change: Y504N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000145375
Gene: ENSMUSG00000030180
AA Change: Y504N

DomainStartEndE-ValueType
JmjN 18 59 4.06e-20 SMART
ARID 81 170 4.76e-35 SMART
BRIGHT 85 175 2.48e-31 SMART
PHD 295 341 1.16e-14 SMART
JmjC 437 603 1.47e-64 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000135802
AA Change: Y504N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000145021
Gene: ENSMUSG00000030180
AA Change: Y504N

DomainStartEndE-ValueType
JmjN 18 59 1.7e-22 SMART
ARID 81 170 3.6e-39 SMART
BRIGHT 85 175 1.2e-33 SMART
PHD 295 341 7.3e-17 SMART
Blast:JmjC 384 436 2e-22 BLAST
JmjC 437 603 2.2e-75 SMART
low complexity region 638 651 N/A INTRINSIC
Pfam:zf-C5HC2 676 728 6.3e-15 PFAM
Pfam:PLU-1 741 811 9.8e-16 PFAM
Meta Mutation Damage Score 0.9676 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.6%
  • 20x: 92.4%
Validation Efficiency 98% (47/48)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the Jumonji, AT-rich interactive domain 1 (JARID1) histone demethylase protein family. The encoded protein plays a role in gene regulation through the histone code by specifically demethylating lysine 4 of histone H3. The encoded protein interacts with many other proteins, including retinoblastoma protein, and is implicated in the transcriptional regulation of Hox genes and cytokines. This gene may play a role in tumor progression. [provided by RefSeq, Aug 2013]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit reduced body size, abnormal involuntary movement and quantitative changes in the hematopoietic stem cell and myeloid progenitor compartments, consistent with enhanced survival and increased cycling. Neonatalsurvival is sensitive to genetic background. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc6 T C 7: 46,018,680 Q168R probably benign Het
Adgrg3 A G 8: 95,035,099 probably benign Het
Apold1 A G 6: 134,983,906 I108V probably benign Het
Atp6v0a2 G A 5: 124,712,796 V429M probably damaging Het
Cbln4 A T 2: 172,037,557 M137K probably damaging Het
Cfap57 A G 4: 118,593,143 V594A probably benign Het
Chd9 A G 8: 90,973,169 E28G possibly damaging Het
Clip4 T A 17: 71,856,546 C704* probably null Het
Col8a2 T A 4: 126,311,115 probably benign Het
Cyp3a59 A G 5: 146,079,383 T17A probably benign Het
Cyp4f14 G A 17: 32,916,879 Q3* probably null Het
Cysltr2 A G 14: 73,029,565 I235T probably damaging Het
Esp34 C A 17: 38,559,555 C45* probably null Het
Gabrg2 T C 11: 41,971,880 K126E possibly damaging Het
Gm4846 A C 1: 166,494,680 probably null Het
Igsf21 T C 4: 140,037,469 N165S possibly damaging Het
Kcnf1 A G 12: 17,175,993 F76L probably benign Het
Kcns1 A G 2: 164,168,257 V194A probably damaging Het
Kdm5b A G 1: 134,627,329 Y1325C possibly damaging Het
Kif1a T C 1: 93,076,292 D156G probably damaging Het
Lrp1b A G 2: 40,802,984 F3401L possibly damaging Het
Lrrc63 A G 14: 75,098,291 Y460H probably damaging Het
Myo15b G T 11: 115,871,456 E1201* probably null Het
Ndor1 A T 2: 25,250,150 I84K probably damaging Het
Ndst4 T A 3: 125,683,170 Y15N probably damaging Het
Olfr1019 A G 2: 85,841,381 S137P probably damaging Het
Olfr609 T C 7: 103,492,633 T82A probably benign Het
Pik3r6 T A 11: 68,533,521 D317E possibly damaging Het
Ppp2r1a G A 17: 20,951,347 R28H probably damaging Het
Ptch1 T G 13: 63,524,959 E944A probably benign Het
Ptpn12 G A 5: 20,992,743 P700L probably benign Het
Setx GTGGCT GT 2: 29,154,061 probably null Het
Slc39a13 T C 2: 91,064,902 probably null Het
Smarca2 G A 19: 26,683,927 probably null Het
Taok1 A T 11: 77,559,833 L371H possibly damaging Het
Tas2r116 A G 6: 132,856,267 H277R probably damaging Het
Treml4 G A 17: 48,264,809 R80Q probably benign Het
Trim9 G A 12: 70,346,352 H273Y probably damaging Het
Tyr A G 7: 87,437,940 S455P probably benign Het
Vmn1r214 G A 13: 23,035,350 C338Y probably benign Het
Vmn2r52 G A 7: 10,170,676 T412I probably benign Het
Wdr70 A T 15: 8,079,214 C149* probably null Het
Wdr93 T A 7: 79,768,411 V294E possibly damaging Het
Other mutations in Kdm5a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00540:Kdm5a APN 6 120385719 critical splice donor site probably null 0.00
IGL00706:Kdm5a APN 6 120406636 missense possibly damaging 0.44
IGL01361:Kdm5a APN 6 120399016 missense probably damaging 1.00
IGL01402:Kdm5a APN 6 120390679 nonsense probably null 0.00
IGL01924:Kdm5a APN 6 120394255 critical splice donor site probably null 0.00
IGL01935:Kdm5a APN 6 120408323 missense probably benign 0.02
IGL02165:Kdm5a APN 6 120415290 missense probably damaging 1.00
IGL02472:Kdm5a APN 6 120406730 splice site probably benign
IGL02506:Kdm5a APN 6 120432149 missense probably damaging 0.99
IGL02604:Kdm5a APN 6 120431980 missense probably benign
IGL02633:Kdm5a APN 6 120364719 missense probably damaging 1.00
IGL02876:Kdm5a APN 6 120390644 unclassified probably benign
IGL03009:Kdm5a APN 6 120430086 missense probably damaging 0.98
IGL03027:Kdm5a APN 6 120374990 splice site probably null
IGL03164:Kdm5a APN 6 120439019 missense probably damaging 1.00
IGL03236:Kdm5a APN 6 120438988 missense probably damaging 0.98
IGL03276:Kdm5a APN 6 120402708 splice site probably benign
Augmented UTSW 6 120430016 intron probably benign
Calla_lily UTSW 6 120405022 missense probably damaging 1.00
crocus UTSW 6 120399038 missense probably null 0.98
Magnolia UTSW 6 120398978 missense probably damaging 0.99
Selbst UTSW 6 120388105 nonsense probably null
R0320:Kdm5a UTSW 6 120389620 missense probably benign 0.19
R0462:Kdm5a UTSW 6 120402600 missense probably damaging 1.00
R0601:Kdm5a UTSW 6 120402671 missense possibly damaging 0.76
R0628:Kdm5a UTSW 6 120415239 missense probably damaging 1.00
R1024:Kdm5a UTSW 6 120399038 missense probably null 0.98
R2013:Kdm5a UTSW 6 120431990 missense probably benign 0.09
R2015:Kdm5a UTSW 6 120431990 missense probably benign 0.09
R2061:Kdm5a UTSW 6 120381617 missense probably benign
R2188:Kdm5a UTSW 6 120406640 missense possibly damaging 0.59
R3923:Kdm5a UTSW 6 120381664 missense probably benign 0.01
R4016:Kdm5a UTSW 6 120394106 missense probably damaging 1.00
R4017:Kdm5a UTSW 6 120394106 missense probably damaging 1.00
R4030:Kdm5a UTSW 6 120405113 nonsense probably null
R4646:Kdm5a UTSW 6 120374977 missense possibly damaging 0.55
R4737:Kdm5a UTSW 6 120406015 intron probably benign
R4779:Kdm5a UTSW 6 120369099 unclassified probably benign
R4836:Kdm5a UTSW 6 120412402 missense probably damaging 1.00
R5129:Kdm5a UTSW 6 120405022 missense probably damaging 1.00
R5182:Kdm5a UTSW 6 120388105 nonsense probably null
R5183:Kdm5a UTSW 6 120430016 intron probably benign
R5572:Kdm5a UTSW 6 120412375 missense possibly damaging 0.69
R6110:Kdm5a UTSW 6 120412306 missense probably damaging 1.00
R6132:Kdm5a UTSW 6 120374931 missense probably damaging 1.00
R6198:Kdm5a UTSW 6 120438997 missense probably benign 0.37
R6246:Kdm5a UTSW 6 120431910 missense probably damaging 0.97
R6336:Kdm5a UTSW 6 120398978 missense probably damaging 0.99
R6343:Kdm5a UTSW 6 120382933 missense probably benign 0.01
R6612:Kdm5a UTSW 6 120430228 missense probably damaging 0.99
R6647:Kdm5a UTSW 6 120412461 missense probably benign 0.25
R7068:Kdm5a UTSW 6 120430215 missense probably benign 0.40
R7369:Kdm5a UTSW 6 120432004 missense possibly damaging 0.67
R7380:Kdm5a UTSW 6 120405918 missense probably benign 0.35
R7411:Kdm5a UTSW 6 120426815 missense probably damaging 1.00
R7521:Kdm5a UTSW 6 120432187 nonsense probably null
R7570:Kdm5a UTSW 6 120427842 missense probably damaging 0.99
R7647:Kdm5a UTSW 6 120427786 missense probably benign 0.01
R7704:Kdm5a UTSW 6 120427064 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCTGAGGTTCTAGAGAGTTATGTCC -3'
(R):5'- TGACTCATACTTTAAGGATCCCTTC -3'

Sequencing Primer
(F):5'- GGTTCTAGAGAGTTATGTCCATATCC -3'
(R):5'- CCATGAGCACATTTGGGT -3'
Posted On2015-04-29