Incidental Mutation 'R4013:Vmn2r52'
ID311817
Institutional Source Beutler Lab
Gene Symbol Vmn2r52
Ensembl Gene ENSMUSG00000091930
Gene Namevomeronasal 2, receptor 52
SynonymsEG384534
MMRRC Submission 040950-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.126) question?
Stock #R4013 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location10158652-10176286 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 10170676 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Isoleucine at position 412 (T412I)
Ref Sequence ENSEMBL: ENSMUSP00000129352 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000164918]
Predicted Effect probably benign
Transcript: ENSMUST00000164918
AA Change: T412I

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000129352
Gene: ENSMUSG00000091930
AA Change: T412I

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Pfam:ANF_receptor 73 469 8.1e-29 PFAM
Pfam:NCD3G 512 565 1.5e-19 PFAM
Pfam:7tm_3 596 833 1.1e-55 PFAM
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.6%
  • 20x: 92.4%
Validation Efficiency 98% (47/48)
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc6 T C 7: 46,018,680 Q168R probably benign Het
Adgrg3 A G 8: 95,035,099 probably benign Het
Apold1 A G 6: 134,983,906 I108V probably benign Het
Atp6v0a2 G A 5: 124,712,796 V429M probably damaging Het
Cbln4 A T 2: 172,037,557 M137K probably damaging Het
Cfap57 A G 4: 118,593,143 V594A probably benign Het
Chd9 A G 8: 90,973,169 E28G possibly damaging Het
Clip4 T A 17: 71,856,546 C704* probably null Het
Col8a2 T A 4: 126,311,115 probably benign Het
Cyp3a59 A G 5: 146,079,383 T17A probably benign Het
Cyp4f14 G A 17: 32,916,879 Q3* probably null Het
Cysltr2 A G 14: 73,029,565 I235T probably damaging Het
Esp34 C A 17: 38,559,555 C45* probably null Het
Gabrg2 T C 11: 41,971,880 K126E possibly damaging Het
Gm4846 A C 1: 166,494,680 probably null Het
Igsf21 T C 4: 140,037,469 N165S possibly damaging Het
Kcnf1 A G 12: 17,175,993 F76L probably benign Het
Kcns1 A G 2: 164,168,257 V194A probably damaging Het
Kdm5a T A 6: 120,394,106 Y504N probably damaging Het
Kdm5b A G 1: 134,627,329 Y1325C possibly damaging Het
Kif1a T C 1: 93,076,292 D156G probably damaging Het
Lrp1b A G 2: 40,802,984 F3401L possibly damaging Het
Lrrc63 A G 14: 75,098,291 Y460H probably damaging Het
Myo15b G T 11: 115,871,456 E1201* probably null Het
Ndor1 A T 2: 25,250,150 I84K probably damaging Het
Ndst4 T A 3: 125,683,170 Y15N probably damaging Het
Olfr1019 A G 2: 85,841,381 S137P probably damaging Het
Olfr609 T C 7: 103,492,633 T82A probably benign Het
Pik3r6 T A 11: 68,533,521 D317E possibly damaging Het
Ppp2r1a G A 17: 20,951,347 R28H probably damaging Het
Ptch1 T G 13: 63,524,959 E944A probably benign Het
Ptpn12 G A 5: 20,992,743 P700L probably benign Het
Setx GTGGCT GT 2: 29,154,061 probably null Het
Slc39a13 T C 2: 91,064,902 probably null Het
Smarca2 G A 19: 26,683,927 probably null Het
Taok1 A T 11: 77,559,833 L371H possibly damaging Het
Tas2r116 A G 6: 132,856,267 H277R probably damaging Het
Treml4 G A 17: 48,264,809 R80Q probably benign Het
Trim9 G A 12: 70,346,352 H273Y probably damaging Het
Tyr A G 7: 87,437,940 S455P probably benign Het
Vmn1r214 G A 13: 23,035,350 C338Y probably benign Het
Wdr70 A T 15: 8,079,214 C149* probably null Het
Wdr93 T A 7: 79,768,411 V294E possibly damaging Het
Other mutations in Vmn2r52
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00088:Vmn2r52 APN 7 10169096 missense probably benign 0.30
IGL00328:Vmn2r52 APN 7 10171417 missense probably benign 0.12
IGL00980:Vmn2r52 APN 7 10171090 missense probably damaging 1.00
IGL01468:Vmn2r52 APN 7 10158941 missense probably damaging 1.00
IGL01660:Vmn2r52 APN 7 10159180 missense probably damaging 0.97
IGL02215:Vmn2r52 APN 7 10171102 missense probably damaging 0.97
IGL03030:Vmn2r52 APN 7 10158872 missense probably benign 0.12
IGL03212:Vmn2r52 APN 7 10159547 missense possibly damaging 0.47
FR4589:Vmn2r52 UTSW 7 10159020 missense probably damaging 0.97
PIT4283001:Vmn2r52 UTSW 7 10170829 missense possibly damaging 0.89
R0184:Vmn2r52 UTSW 7 10159338 missense probably damaging 1.00
R0190:Vmn2r52 UTSW 7 10171388 missense probably benign 0.00
R0240:Vmn2r52 UTSW 7 10159400 missense probably damaging 0.99
R0240:Vmn2r52 UTSW 7 10159400 missense probably damaging 0.99
R0257:Vmn2r52 UTSW 7 10171055 nonsense probably null
R0310:Vmn2r52 UTSW 7 10159466 missense probably damaging 1.00
R1831:Vmn2r52 UTSW 7 10159488 missense probably damaging 1.00
R1862:Vmn2r52 UTSW 7 10173406 missense possibly damaging 0.94
R2484:Vmn2r52 UTSW 7 10169131 missense probably damaging 0.96
R2510:Vmn2r52 UTSW 7 10170868 missense probably benign
R3625:Vmn2r52 UTSW 7 10159178 missense probably damaging 1.00
R3803:Vmn2r52 UTSW 7 10173512 missense probably damaging 1.00
R4283:Vmn2r52 UTSW 7 10170638 missense possibly damaging 0.60
R4324:Vmn2r52 UTSW 7 10171013 missense possibly damaging 0.94
R4578:Vmn2r52 UTSW 7 10170690 missense probably damaging 1.00
R4806:Vmn2r52 UTSW 7 10159242 missense probably damaging 1.00
R5083:Vmn2r52 UTSW 7 10159465 nonsense probably null
R5249:Vmn2r52 UTSW 7 10176270 missense probably benign
R5306:Vmn2r52 UTSW 7 10170745 missense possibly damaging 0.88
R5332:Vmn2r52 UTSW 7 10169125 missense probably benign 0.17
R5617:Vmn2r52 UTSW 7 10170934 missense probably damaging 0.99
R5643:Vmn2r52 UTSW 7 10171132 missense probably damaging 1.00
R5749:Vmn2r52 UTSW 7 10159032 missense probably damaging 1.00
R5763:Vmn2r52 UTSW 7 10171304 missense probably benign 0.01
R6103:Vmn2r52 UTSW 7 10171400 missense probably benign 0.36
R6148:Vmn2r52 UTSW 7 10171163 missense probably benign 0.00
R6356:Vmn2r52 UTSW 7 10168999 missense probably benign 0.01
R6412:Vmn2r52 UTSW 7 10171009 missense probably benign
R6657:Vmn2r52 UTSW 7 10159163 missense probably damaging 0.99
R6997:Vmn2r52 UTSW 7 10169071 missense probably benign 0.06
R7395:Vmn2r52 UTSW 7 10170817 missense probably benign 0.00
R7621:Vmn2r52 UTSW 7 10173347 missense probably benign 0.00
R7691:Vmn2r52 UTSW 7 10159182 missense probably damaging 0.97
R7852:Vmn2r52 UTSW 7 10158968 missense probably damaging 1.00
R7908:Vmn2r52 UTSW 7 10162950 missense probably benign
R7909:Vmn2r52 UTSW 7 10162950 missense probably benign
R7912:Vmn2r52 UTSW 7 10162950 missense probably benign
R7913:Vmn2r52 UTSW 7 10162950 missense probably benign
R7935:Vmn2r52 UTSW 7 10158968 missense probably damaging 1.00
R7993:Vmn2r52 UTSW 7 10162950 missense probably benign
R7994:Vmn2r52 UTSW 7 10162950 missense probably benign
Z1176:Vmn2r52 UTSW 7 10171200 missense probably damaging 0.97
Z1177:Vmn2r52 UTSW 7 10169190 missense possibly damaging 0.93
Predicted Primers PCR Primer
(F):5'- CCCCGAAATTTTCATCGATAATCTG -3'
(R):5'- TTGTTCCATCTCAAAAGCACAG -3'

Sequencing Primer
(F):5'- TCTAGACATCTGAGAGACAC -3'
(R):5'- CATTTCTAGTAATGCCAGAGTGG -3'
Posted On2015-04-29