Incidental Mutation 'R4013:Abcc6'
ID 311818
Institutional Source Beutler Lab
Gene Symbol Abcc6
Ensembl Gene ENSMUSG00000030834
Gene Name ATP-binding cassette, sub-family C member 6
Synonyms DCC, Mrp6, Dyscalc1
MMRRC Submission 040950-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.788) question?
Stock # R4013 (G1)
Quality Score 225
Status Validated
Chromosome 7
Chromosomal Location 45625804-45679915 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 45668104 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Glutamine to Arginine at position 168 (Q168R)
Ref Sequence ENSEMBL: ENSMUSP00000002850 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000002850]
AlphaFold Q9R1S7
Predicted Effect probably benign
Transcript: ENSMUST00000002850
AA Change: Q168R

PolyPhen 2 Score 0.011 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000002850
Gene: ENSMUSG00000030834
AA Change: Q168R

DomainStartEndE-ValueType
transmembrane domain 44 61 N/A INTRINSIC
transmembrane domain 81 100 N/A INTRINSIC
transmembrane domain 110 129 N/A INTRINSIC
transmembrane domain 142 161 N/A INTRINSIC
transmembrane domain 171 193 N/A INTRINSIC
Pfam:ABC_membrane 309 580 3.5e-29 PFAM
AAA 653 828 1.19e-9 SMART
low complexity region 871 885 N/A INTRINSIC
Pfam:ABC_membrane 942 1211 2.5e-32 PFAM
AAA 1286 1473 1.71e-10 SMART
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.6%
  • 20x: 92.4%
Validation Efficiency 98% (47/48)
MGI Phenotype FUNCTION: The protein encoded by this gene is a member of the superfamily of ATP-binding cassette (ABC) transporters. ABC proteins transport various molecules across extra- and intra-cellular membranes. ABC genes are divided into seven distinct subfamilies (ABC1, MDR/TAP, MRP, ALD, OABP, GCN20, White). This protein is a member of the MRP subfamily which is involved in multi-drug resistance. The specific function of this protein is unknown; however, a similar rat protein has been identified as the major canalicular bile salt export pump of liver. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mice display patchy mineralization which may include the capsule surrounding the sinuses of vibrissae, medium sized arteries, skin, retina, kidney, and interscapular brown fat. Strain differences at this locus may lead to altered susceptibility to cardiac calcinosis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrg3 A G 8: 95,761,727 (GRCm39) probably benign Het
Apold1 A G 6: 134,960,869 (GRCm39) I108V probably benign Het
Atp6v0a2 G A 5: 124,789,860 (GRCm39) V429M probably damaging Het
Cbln4 A T 2: 171,879,477 (GRCm39) M137K probably damaging Het
Cfap57 A G 4: 118,450,340 (GRCm39) V594A probably benign Het
Chd9 A G 8: 91,699,797 (GRCm39) E28G possibly damaging Het
Clip4 T A 17: 72,163,541 (GRCm39) C704* probably null Het
Col8a2 T A 4: 126,204,908 (GRCm39) probably benign Het
Cyp3a59 A G 5: 146,016,193 (GRCm39) T17A probably benign Het
Cyp4f14 G A 17: 33,135,853 (GRCm39) Q3* probably null Het
Cysltr2 A G 14: 73,267,005 (GRCm39) I235T probably damaging Het
Esp34 C A 17: 38,870,446 (GRCm39) C45* probably null Het
Gabrg2 T C 11: 41,862,707 (GRCm39) K126E possibly damaging Het
Gm4846 A C 1: 166,322,249 (GRCm39) probably null Het
Igsf21 T C 4: 139,764,780 (GRCm39) N165S possibly damaging Het
Kcnf1 A G 12: 17,225,994 (GRCm39) F76L probably benign Het
Kcns1 A G 2: 164,010,177 (GRCm39) V194A probably damaging Het
Kdm5a T A 6: 120,371,067 (GRCm39) Y504N probably damaging Het
Kdm5b A G 1: 134,555,067 (GRCm39) Y1325C possibly damaging Het
Kif1a T C 1: 93,004,014 (GRCm39) D156G probably damaging Het
Lrp1b A G 2: 40,692,996 (GRCm39) F3401L possibly damaging Het
Lrrc63 A G 14: 75,335,731 (GRCm39) Y460H probably damaging Het
Myo15b G T 11: 115,762,282 (GRCm39) E1201* probably null Het
Ndor1 A T 2: 25,140,162 (GRCm39) I84K probably damaging Het
Ndst4 T A 3: 125,476,819 (GRCm39) Y15N probably damaging Het
Or51af1 T C 7: 103,141,840 (GRCm39) T82A probably benign Het
Or5ar1 A G 2: 85,671,725 (GRCm39) S137P probably damaging Het
Pik3r6 T A 11: 68,424,347 (GRCm39) D317E possibly damaging Het
Ppp2r1a G A 17: 21,171,609 (GRCm39) R28H probably damaging Het
Ptch1 T G 13: 63,672,773 (GRCm39) E944A probably benign Het
Ptpn12 G A 5: 21,197,741 (GRCm39) P700L probably benign Het
Setx GTGGCT GT 2: 29,044,073 (GRCm39) 1814 probably null Het
Slc39a13 T C 2: 90,895,247 (GRCm39) probably null Het
Smarca2 G A 19: 26,661,327 (GRCm39) probably null Het
Taok1 A T 11: 77,450,659 (GRCm39) L371H possibly damaging Het
Tas2r116 A G 6: 132,833,230 (GRCm39) H277R probably damaging Het
Treml4 G A 17: 48,571,837 (GRCm39) R80Q probably benign Het
Trim9 G A 12: 70,393,126 (GRCm39) H273Y probably damaging Het
Tyr A G 7: 87,087,148 (GRCm39) S455P probably benign Het
Vmn1r214 G A 13: 23,219,520 (GRCm39) C338Y probably benign Het
Vmn2r52 G A 7: 9,904,603 (GRCm39) T412I probably benign Het
Wdr70 A T 15: 8,108,698 (GRCm39) C149* probably null Het
Wdr93 T A 7: 79,418,159 (GRCm39) V294E possibly damaging Het
Other mutations in Abcc6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01589:Abcc6 APN 7 45,652,096 (GRCm39) splice site probably benign
IGL01731:Abcc6 APN 7 45,652,034 (GRCm39) missense possibly damaging 0.71
IGL01743:Abcc6 APN 7 45,646,238 (GRCm39) missense probably benign 0.02
IGL01757:Abcc6 APN 7 45,639,705 (GRCm39) splice site probably benign
IGL01895:Abcc6 APN 7 45,678,482 (GRCm39) missense possibly damaging 0.88
IGL01942:Abcc6 APN 7 45,635,997 (GRCm39) missense possibly damaging 0.89
IGL02251:Abcc6 APN 7 45,626,840 (GRCm39) missense probably damaging 1.00
IGL02277:Abcc6 APN 7 45,650,485 (GRCm39) missense probably benign 0.00
IGL02548:Abcc6 APN 7 45,654,686 (GRCm39) missense probably damaging 0.98
IGL03063:Abcc6 APN 7 45,665,856 (GRCm39) missense probably benign
IGL03092:Abcc6 APN 7 45,635,894 (GRCm39) missense probably damaging 1.00
IGL03251:Abcc6 APN 7 45,631,661 (GRCm39) unclassified probably benign
R0057:Abcc6 UTSW 7 45,669,567 (GRCm39) missense probably benign 0.03
R0944:Abcc6 UTSW 7 45,664,929 (GRCm39) missense possibly damaging 0.81
R1019:Abcc6 UTSW 7 45,663,531 (GRCm39) missense possibly damaging 0.77
R1183:Abcc6 UTSW 7 45,634,677 (GRCm39) missense probably damaging 0.99
R1543:Abcc6 UTSW 7 45,665,928 (GRCm39) missense probably benign 0.01
R1550:Abcc6 UTSW 7 45,654,668 (GRCm39) missense probably benign 0.25
R1725:Abcc6 UTSW 7 45,641,781 (GRCm39) missense possibly damaging 0.76
R1907:Abcc6 UTSW 7 45,663,593 (GRCm39) missense probably benign 0.04
R1908:Abcc6 UTSW 7 45,669,558 (GRCm39) splice site probably null
R1909:Abcc6 UTSW 7 45,669,558 (GRCm39) splice site probably null
R2138:Abcc6 UTSW 7 45,630,475 (GRCm39) missense probably damaging 1.00
R2145:Abcc6 UTSW 7 45,648,165 (GRCm39) missense probably benign 0.01
R2402:Abcc6 UTSW 7 45,664,999 (GRCm39) missense probably benign 0.04
R3983:Abcc6 UTSW 7 45,644,713 (GRCm39) missense probably benign
R4051:Abcc6 UTSW 7 45,635,987 (GRCm39) missense probably damaging 1.00
R4052:Abcc6 UTSW 7 45,635,987 (GRCm39) missense probably damaging 1.00
R4208:Abcc6 UTSW 7 45,635,987 (GRCm39) missense probably damaging 1.00
R4362:Abcc6 UTSW 7 45,648,256 (GRCm39) splice site probably benign
R4385:Abcc6 UTSW 7 45,644,752 (GRCm39) missense possibly damaging 0.93
R4399:Abcc6 UTSW 7 45,652,031 (GRCm39) missense probably benign
R4479:Abcc6 UTSW 7 45,654,663 (GRCm39) missense possibly damaging 0.60
R4480:Abcc6 UTSW 7 45,654,663 (GRCm39) missense possibly damaging 0.60
R4780:Abcc6 UTSW 7 45,646,115 (GRCm39) missense probably benign
R4791:Abcc6 UTSW 7 45,631,584 (GRCm39) missense probably benign 0.00
R4895:Abcc6 UTSW 7 45,630,414 (GRCm39) missense possibly damaging 0.95
R4898:Abcc6 UTSW 7 45,639,111 (GRCm39) missense probably damaging 0.96
R4905:Abcc6 UTSW 7 45,644,649 (GRCm39) missense probably benign
R4941:Abcc6 UTSW 7 45,661,947 (GRCm39) missense probably benign 0.00
R5040:Abcc6 UTSW 7 45,669,578 (GRCm39) missense probably benign 0.04
R5128:Abcc6 UTSW 7 45,639,070 (GRCm39) missense probably benign 0.00
R5284:Abcc6 UTSW 7 45,630,483 (GRCm39) missense probably benign 0.05
R5328:Abcc6 UTSW 7 45,641,735 (GRCm39) missense probably benign 0.01
R5459:Abcc6 UTSW 7 45,631,607 (GRCm39) missense probably benign 0.00
R5543:Abcc6 UTSW 7 45,638,960 (GRCm39) critical splice donor site probably null
R6178:Abcc6 UTSW 7 45,678,468 (GRCm39) missense probably benign
R6228:Abcc6 UTSW 7 45,679,680 (GRCm39) missense probably benign 0.02
R6532:Abcc6 UTSW 7 45,626,803 (GRCm39) missense probably damaging 1.00
R6605:Abcc6 UTSW 7 45,630,481 (GRCm39) missense probably damaging 1.00
R7000:Abcc6 UTSW 7 45,654,946 (GRCm39) missense possibly damaging 0.60
R7067:Abcc6 UTSW 7 45,668,114 (GRCm39) missense probably benign
R7553:Abcc6 UTSW 7 45,648,545 (GRCm39) missense probably damaging 1.00
R7597:Abcc6 UTSW 7 45,644,661 (GRCm39) missense probably damaging 1.00
R7718:Abcc6 UTSW 7 45,626,816 (GRCm39) missense possibly damaging 0.91
R7781:Abcc6 UTSW 7 45,655,030 (GRCm39) missense probably damaging 1.00
R7798:Abcc6 UTSW 7 45,626,277 (GRCm39) nonsense probably null
R7896:Abcc6 UTSW 7 45,626,803 (GRCm39) missense probably damaging 1.00
R8098:Abcc6 UTSW 7 45,646,089 (GRCm39) missense probably damaging 1.00
R8443:Abcc6 UTSW 7 45,629,449 (GRCm39) missense probably damaging 1.00
R8773:Abcc6 UTSW 7 45,634,569 (GRCm39) missense probably benign
R8784:Abcc6 UTSW 7 45,652,025 (GRCm39) missense probably benign
R8802:Abcc6 UTSW 7 45,658,283 (GRCm39) missense probably damaging 0.99
R8807:Abcc6 UTSW 7 45,648,431 (GRCm39) missense possibly damaging 0.67
R9006:Abcc6 UTSW 7 45,665,820 (GRCm39) missense probably benign 0.00
R9127:Abcc6 UTSW 7 45,629,184 (GRCm39) missense probably damaging 1.00
R9475:Abcc6 UTSW 7 45,665,892 (GRCm39) missense probably damaging 1.00
R9480:Abcc6 UTSW 7 45,629,197 (GRCm39) missense probably damaging 1.00
R9535:Abcc6 UTSW 7 45,626,687 (GRCm39) missense probably damaging 1.00
R9642:Abcc6 UTSW 7 45,639,765 (GRCm39) missense probably benign 0.07
R9715:Abcc6 UTSW 7 45,629,359 (GRCm39) missense probably damaging 1.00
R9731:Abcc6 UTSW 7 45,669,660 (GRCm39) nonsense probably null
X0065:Abcc6 UTSW 7 45,669,621 (GRCm39) missense probably damaging 0.99
Z1176:Abcc6 UTSW 7 45,641,730 (GRCm39) critical splice donor site probably null
Z1176:Abcc6 UTSW 7 45,629,158 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTGTGCTCTAGGCCAACAC -3'
(R):5'- AGTAACATGCCATGAGCCAGG -3'

Sequencing Primer
(F):5'- GTGCTCTAGGCCAACACACATTG -3'
(R):5'- CATGCCATGAGCCAGGATGAC -3'
Posted On 2015-04-29