Incidental Mutation 'R4013:Cysltr2'
ID311833
Institutional Source Beutler Lab
Gene Symbol Cysltr2
Ensembl Gene ENSMUSG00000033470
Gene Namecysteinyl leukotriene receptor 2
SynonymsCYSLT2R, 2300001H05Rik, Cyslt2, CysLT2
MMRRC Submission 040950-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.064) question?
Stock #R4013 (G1)
Quality Score216
Status Validated
Chromosome14
Chromosomal Location73025603-73049114 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 73029565 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 235 (I235T)
Ref Sequence ENSEMBL: ENSMUSP00000125958 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000044664] [ENSMUST00000169168]
Predicted Effect probably damaging
Transcript: ENSMUST00000044664
AA Change: I235T

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000040715
Gene: ENSMUSG00000033470
AA Change: I235T

DomainStartEndE-ValueType
Pfam:TAS2R 18 307 1.6e-8 PFAM
Pfam:7tm_1 39 289 2.5e-50 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000169168
AA Change: I235T

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000125958
Gene: ENSMUSG00000033470
AA Change: I235T

DomainStartEndE-ValueType
Pfam:TAS2R 18 307 1.4e-8 PFAM
Pfam:7tm_1 39 289 1.3e-43 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000226727
Predicted Effect noncoding transcript
Transcript: ENSMUST00000228154
Meta Mutation Damage Score 0.1938 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.6%
  • 20x: 92.4%
Validation Efficiency 98% (47/48)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The cysteinyl leukotrienes LTC4, LTD4, and LTE4 are important mediators of human bronchial asthma. Pharmacologic studies have determined that cysteinyl leukotrienes activate at least 2 receptors, the protein encoded by this gene and CYSLTR1. This encoded receptor is a member of the superfamily of G protein-coupled receptors. It seems to play a major role in endocrine and cardiovascular systems. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mice display reduced bleomycin-induced pulmonary fibrosis and reduced IgE dependent passive cutaneous anaphylaxis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc6 T C 7: 46,018,680 Q168R probably benign Het
Adgrg3 A G 8: 95,035,099 probably benign Het
Apold1 A G 6: 134,983,906 I108V probably benign Het
Atp6v0a2 G A 5: 124,712,796 V429M probably damaging Het
Cbln4 A T 2: 172,037,557 M137K probably damaging Het
Cfap57 A G 4: 118,593,143 V594A probably benign Het
Chd9 A G 8: 90,973,169 E28G possibly damaging Het
Clip4 T A 17: 71,856,546 C704* probably null Het
Col8a2 T A 4: 126,311,115 probably benign Het
Cyp3a59 A G 5: 146,079,383 T17A probably benign Het
Cyp4f14 G A 17: 32,916,879 Q3* probably null Het
Esp34 C A 17: 38,559,555 C45* probably null Het
Gabrg2 T C 11: 41,971,880 K126E possibly damaging Het
Gm4846 A C 1: 166,494,680 probably null Het
Igsf21 T C 4: 140,037,469 N165S possibly damaging Het
Kcnf1 A G 12: 17,175,993 F76L probably benign Het
Kcns1 A G 2: 164,168,257 V194A probably damaging Het
Kdm5a T A 6: 120,394,106 Y504N probably damaging Het
Kdm5b A G 1: 134,627,329 Y1325C possibly damaging Het
Kif1a T C 1: 93,076,292 D156G probably damaging Het
Lrp1b A G 2: 40,802,984 F3401L possibly damaging Het
Lrrc63 A G 14: 75,098,291 Y460H probably damaging Het
Myo15b G T 11: 115,871,456 E1201* probably null Het
Ndor1 A T 2: 25,250,150 I84K probably damaging Het
Ndst4 T A 3: 125,683,170 Y15N probably damaging Het
Olfr1019 A G 2: 85,841,381 S137P probably damaging Het
Olfr609 T C 7: 103,492,633 T82A probably benign Het
Pik3r6 T A 11: 68,533,521 D317E possibly damaging Het
Ppp2r1a G A 17: 20,951,347 R28H probably damaging Het
Ptch1 T G 13: 63,524,959 E944A probably benign Het
Ptpn12 G A 5: 20,992,743 P700L probably benign Het
Setx GTGGCT GT 2: 29,154,061 probably null Het
Slc39a13 T C 2: 91,064,902 probably null Het
Smarca2 G A 19: 26,683,927 probably null Het
Taok1 A T 11: 77,559,833 L371H possibly damaging Het
Tas2r116 A G 6: 132,856,267 H277R probably damaging Het
Treml4 G A 17: 48,264,809 R80Q probably benign Het
Trim9 G A 12: 70,346,352 H273Y probably damaging Het
Tyr A G 7: 87,437,940 S455P probably benign Het
Vmn1r214 G A 13: 23,035,350 C338Y probably benign Het
Vmn2r52 G A 7: 10,170,676 T412I probably benign Het
Wdr70 A T 15: 8,079,214 C149* probably null Het
Wdr93 T A 7: 79,768,411 V294E possibly damaging Het
Other mutations in Cysltr2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03211:Cysltr2 APN 14 73029715 missense possibly damaging 0.90
R1223:Cysltr2 UTSW 14 73030099 missense probably damaging 1.00
R1689:Cysltr2 UTSW 14 73030030 missense possibly damaging 0.75
R1695:Cysltr2 UTSW 14 73029881 missense probably benign 0.01
R1898:Cysltr2 UTSW 14 73029533 missense probably damaging 1.00
R3968:Cysltr2 UTSW 14 73030174 missense probably damaging 0.99
R4357:Cysltr2 UTSW 14 73029644 missense probably benign 0.15
R4444:Cysltr2 UTSW 14 73029893 missense possibly damaging 0.74
R4445:Cysltr2 UTSW 14 73029893 missense possibly damaging 0.74
R5207:Cysltr2 UTSW 14 73029511 missense probably damaging 0.99
R5591:Cysltr2 UTSW 14 73029491 missense probably benign 0.00
R5592:Cysltr2 UTSW 14 73029491 missense probably benign 0.00
R5593:Cysltr2 UTSW 14 73029491 missense probably benign 0.00
R5839:Cysltr2 UTSW 14 73030183 missense probably damaging 1.00
R5885:Cysltr2 UTSW 14 73029491 missense probably benign 0.00
R5886:Cysltr2 UTSW 14 73029491 missense probably benign 0.00
R5934:Cysltr2 UTSW 14 73029491 missense probably benign 0.00
R5940:Cysltr2 UTSW 14 73029491 missense probably benign 0.00
R5940:Cysltr2 UTSW 14 73029949 missense probably damaging 1.00
R7775:Cysltr2 UTSW 14 73029763 missense probably benign 0.00
R7778:Cysltr2 UTSW 14 73029763 missense probably benign 0.00
R7824:Cysltr2 UTSW 14 73029763 missense probably benign 0.00
X0009:Cysltr2 UTSW 14 73029979 missense probably benign 0.04
Predicted Primers PCR Primer
(F):5'- AGCCCTTAATCGAGCTTTGAAATTC -3'
(R):5'- ATCATGCTTGGAGCTGAGTCC -3'

Sequencing Primer
(F):5'- AATCGAGCTTTGAAATTCTCCCCAG -3'
(R):5'- CTTGGAGCTGAGTCCTCAAAAG -3'
Posted On2015-04-29