Mutagenetix > Incidental Mutation

Incidental Mutation 'R4014:Tyr'

311859

Institutional Source

Beutler Lab

Gene Symbol

Tyr

Ensembl Gene

ENSMUSG00000004651

Gene Name

tyrosinase

Synonyms

Oca1, skc35

MMRRC Submission

040951-MU

Accession Numbers

Ncbi RefSeq: NM_011661.4; MGI:98880

Essential gene?

Possibly non essential (E-score: 0.361) question?

Stock #

R4014 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

87424771-87493512 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 87437940 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Serine to Proline at position 455 (S455P)

Ref Sequence

ENSEMBL: ENSMUSP00000004770 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000004770]

AlphaFold

P11344

Predicted Effect

probably benign
Transcript: ENSMUST00000004770
AA Change: S455P

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)

SMART Domains

Protein: ENSMUSP00000004770
Gene: ENSMUSG00000004651
AA Change: S455P

Domain	Start	End	E-Value	Type
signal peptide	1	18	N/A	INTRINSIC
low complexity region	91	112	N/A	INTRINSIC
Pfam:Tyrosinase	170	403	4.8e-45	PFAM
transmembrane domain	474	496	N/A	INTRINSIC

Meta Mutation Damage Score

0.0593

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 96.9%
20x: 93.6%

Validation Efficiency

100% (49/49)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The enzyme encoded by this gene catalyzes the first 2 steps, and at least 1 subsequent step, in the conversion of tyrosine to melanin. The enzyme has both tyrosine hydroxylase and dopa oxidase catalytic activities, and requires copper for function. Mutations in this gene result in oculocutaneous albinism, and nonpathologic polymorphisms result in skin pigmentation variation. The human genome contains a pseudogene similar to the 3' half of this gene. [provided by RefSeq, Oct 2008]
PHENOTYPE: Numerous mutations at this locus result in albinism or hypopigmentation. Albinism is associated with reduced number of optic nerve fibers and mutants can have impaired vision. Some alleles are lethal. [provided by MGI curators]

Allele List at MGI

All alleles(120) : Targeted(2) Spontaneous(28) Chemically induced(16) Radiation induced(78)

Other mutations in this stock

Total: 47 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abcc2	A	T	19: 43,823,120	Q1008L	probably benign	Het
Adgrg7	A	G	16: 56,742,288	F562S	probably damaging	Het
Alms1	T	A	6: 85,678,352	N3293K	probably benign	Het
Cdk20	T	A	13: 64,437,505	V201D	probably benign	Het
Cenpf	A	G	1: 189,653,159	V2308A	probably benign	Het
Chek1	T	C	9: 36,722,754		probably benign	Het
Ciz1	G	T	2: 32,374,344	E497D	probably damaging	Het
Clcn6	A	G	4: 148,017,610	F339S	probably damaging	Het
Dctpp1	G	A	7: 127,257,113	R146C	probably damaging	Het
Dennd5a	C	T	7: 109,935,481		probably null	Het
Dmxl1	G	A	18: 49,863,962	V442I	probably benign	Het
Dmxl2	C	A	9: 54,378,709		probably null	Het
Dnah11	A	G	12: 117,974,914	I3273T	probably benign	Het
Dnhd1	T	A	7: 105,714,838	D4132E	probably damaging	Het
Dst	G	A	1: 34,191,282	W2327*	probably null	Het
Epb41	A	T	4: 131,982,445		probably benign	Het
Frem2	C	T	3: 53,652,353	V1578I	probably benign	Het
Fsip2	A	G	2: 82,983,518	T3394A	probably benign	Het
Gabra5	C	T	7: 57,489,010	D97N	probably damaging	Het
Habp2	A	G	19: 56,319,622	E546G	probably benign	Het
Hace1	A	G	10: 45,588,374		probably benign	Het
Herc4	T	C	10: 63,287,544	S433P	probably benign	Het
Igf2bp2	T	C	16: 22,063,676	N425S	probably damaging	Het
Krt26	C	T	11: 99,335,302	G189S	probably damaging	Het
Lama2	A	T	10: 26,984,376	D3038E	probably damaging	Het
Lmbrd2	T	C	15: 9,151,585		probably benign	Het
Lrp1b	A	G	2: 40,802,984	F3401L	possibly damaging	Het
Map2k7	T	A	8: 4,247,663	S421R	possibly damaging	Het
Matn1	A	G	4: 130,951,947	Q304R	possibly damaging	Het
Muc4	C	T	16: 32,755,273		probably benign	Het
Muc5b	G	A	7: 141,863,630	V3438M	probably benign	Het
Myo3a	A	G	2: 22,578,170	R479G	possibly damaging	Het
Mzf1	A	G	7: 13,043,956	V586A	possibly damaging	Het
Olfr1016	A	T	2: 85,799,476	Y265N	probably damaging	Het
Olfr834	T	C	9: 18,988,882	V298A	probably benign	Het
Pcdhgb7	A	T	18: 37,752,363	E195D	probably benign	Het
Pde4b	A	G	4: 102,555,625	D199G	probably benign	Het
Rnf213	C	T	11: 119,445,729	Q3309*	probably null	Het
Setx	GTGGCT	GT	2: 29,154,061	1814	probably null	Het
Slc22a4	C	G	11: 53,997,392	C270S	probably benign	Het
Smarca2	G	A	19: 26,683,927		probably null	Het
Spata31d1c	T	C	13: 65,035,399	S252P	probably damaging	Het
Urb1	A	T	16: 90,769,465	M1478K	probably damaging	Het
Usp1	A	G	4: 98,934,702	D751G	probably damaging	Het
Vmn1r214	G	A	13: 23,035,350	C338Y	probably benign	Het
Vmn2r103	A	G	17: 19,793,604	I219M	possibly damaging	Het
Wwp2	A	G	8: 107,485,621	N139S	probably benign	Het

Other mutations in Tyr

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01568:Tyr	APN	7	87437948	missense	probably damaging	1.00
IGL01594:Tyr	APN	7	87483814	splice site	probably benign
IGL02963:Tyr	APN	7	87483997	missense	probably benign
IGL03356:Tyr	APN	7	87492714	missense	possibly damaging	0.71
ghost	UTSW	7	87472495	missense	probably damaging	1.00
pale	UTSW	7	87437967	missense	probably damaging	1.00
pale_rider	UTSW	7	87438023	missense	probably damaging	1.00
rufus	UTSW	7	87492706	missense	probably damaging	1.00
shocked	UTSW	7	87493122	missense	probably damaging	1.00
siamese	UTSW	7	87438044	missense	probably damaging	0.99
Venusaur	UTSW	7	87492706	missense	probably damaging	1.00
waffle	UTSW	7	87493221	missense	possibly damaging	0.94
R0322:Tyr	UTSW	7	87492917	missense	probably benign	0.35
R0479:Tyr	UTSW	7	87493221	missense	possibly damaging	0.94
R1544:Tyr	UTSW	7	87492706	missense	probably damaging	1.00
R1546:Tyr	UTSW	7	87437992	missense	probably benign	0.02
R1606:Tyr	UTSW	7	87437971	missense	probably benign	0.01
R1666:Tyr	UTSW	7	87492941	missense	probably damaging	1.00
R2064:Tyr	UTSW	7	87492843	missense	probably benign	0.13
R2213:Tyr	UTSW	7	87492878	missense	probably damaging	1.00
R2420:Tyr	UTSW	7	87429189	missense	probably benign	0.17
R4013:Tyr	UTSW	7	87437940	missense	probably benign	0.00
R4015:Tyr	UTSW	7	87437940	missense	probably benign	0.00
R4016:Tyr	UTSW	7	87437940	missense	probably benign	0.00
R4202:Tyr	UTSW	7	87429068	missense	possibly damaging	0.92
R4205:Tyr	UTSW	7	87429068	missense	possibly damaging	0.92
R4206:Tyr	UTSW	7	87429068	missense	possibly damaging	0.92
R4361:Tyr	UTSW	7	87429076	missense	probably benign	0.01
R4738:Tyr	UTSW	7	87492647	missense	probably null	1.00
R5306:Tyr	UTSW	7	87438014	missense	probably damaging	1.00
R5378:Tyr	UTSW	7	87472495	missense	probably damaging	1.00
R5395:Tyr	UTSW	7	87472490	missense	probably damaging	0.98
R5782:Tyr	UTSW	7	87493016	missense	probably damaging	1.00
R7007:Tyr	UTSW	7	87493340	missense	probably benign	0.04
R7609:Tyr	UTSW	7	87483884	missense	probably benign	0.06
R7767:Tyr	UTSW	7	87493010	missense	probably benign	0.37
R7794:Tyr	UTSW	7	87483820	critical splice donor site	probably null
R8158:Tyr	UTSW	7	87472516	missense	probably damaging	0.99
R8383:Tyr	UTSW	7	87483992	missense	probably damaging	1.00
R8403:Tyr	UTSW	7	87437967	missense	probably damaging	1.00
R8544:Tyr	UTSW	7	87492792	missense	probably benign	0.05
R8822:Tyr	UTSW	7	87493122	missense	probably damaging	1.00
R8837:Tyr	UTSW	7	87438015	missense	probably damaging	1.00
R9492:Tyr	UTSW	7	87472496	missense	probably damaging	1.00
R9492:Tyr	UTSW	7	87472497	missense	possibly damaging	0.63
R9748:Tyr	UTSW	7	87492864	missense	possibly damaging	0.89

Predicted Primers

PCR Primer
(F):5'- ATGGTTCAAAAGCTTCCCAATC -3'
(R):5'- TTGAACAATGGCTGCGAAGG -3'

Sequencing Primer
(F):5'- TCAAAAGCTTCCCAATCCTATATTC -3'
(R):5'- GCACCGCCCTCTTTTGGAAG -3'

Posted On

2015-04-29