Incidental Mutation 'R4014:Wwp2'
ID311865
Institutional Source Beutler Lab
Gene Symbol Wwp2
Ensembl Gene ENSMUSG00000031930
Gene NameWW domain containing E3 ubiquitin protein ligase 2
SynonymsAIP2, 1300010O06Rik
MMRRC Submission 040951-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.559) question?
Stock #R4014 (G1)
Quality Score225
Status Validated
Chromosome8
Chromosomal Location107436365-107558595 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 107485621 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 139 (N139S)
Ref Sequence ENSEMBL: ENSMUSP00000148679 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000166615] [ENSMUST00000212205]
Predicted Effect probably benign
Transcript: ENSMUST00000166615
AA Change: N185S

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000132224
Gene: ENSMUSG00000031930
AA Change: N185S

DomainStartEndE-ValueType
C2 19 115 1.52e-6 SMART
low complexity region 188 208 N/A INTRINSIC
low complexity region 237 249 N/A INTRINSIC
WW 301 330 4.61e-8 SMART
WW 331 363 4.33e-13 SMART
WW 406 437 2.86e-13 SMART
WW 445 477 3.6e-10 SMART
HECTc 534 870 3.24e-201 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000212063
Predicted Effect probably benign
Transcript: ENSMUST00000212205
AA Change: N139S

PolyPhen 2 Score 0.025 (Sensitivity: 0.95; Specificity: 0.81)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000212645
Predicted Effect noncoding transcript
Transcript: ENSMUST00000212906
Meta Mutation Damage Score 0.0588 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 93.6%
Validation Efficiency 100% (49/49)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the Nedd4 family of E3 ligases, which play an important role in protein ubiquitination. The encoded protein contains four WW domains and may play a role in multiple processes including chondrogenesis and the regulation of oncogenic signaling pathways via interactions with Smad proteins and the tumor suppressor PTEN. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene, and a pseudogene of this gene is located on the long arm of chromosome 10. [provided by RefSeq, Jul 2012]
PHENOTYPE: Mice homozygous for a gene trapped allele exhibit decreased body size, domed skull, short snout, twisted snout and overgrown mandibular incisors. Mice homozygous for a different knock-out allele exhibit increased sensitivity to pIpC-treatment. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc2 A T 19: 43,823,120 Q1008L probably benign Het
Adgrg7 A G 16: 56,742,288 F562S probably damaging Het
Alms1 T A 6: 85,678,352 N3293K probably benign Het
Cdk20 T A 13: 64,437,505 V201D probably benign Het
Cenpf A G 1: 189,653,159 V2308A probably benign Het
Chek1 T C 9: 36,722,754 probably benign Het
Ciz1 G T 2: 32,374,344 E497D probably damaging Het
Clcn6 A G 4: 148,017,610 F339S probably damaging Het
Dctpp1 G A 7: 127,257,113 R146C probably damaging Het
Dennd5a C T 7: 109,935,481 probably null Het
Dmxl1 G A 18: 49,863,962 V442I probably benign Het
Dmxl2 C A 9: 54,378,709 probably null Het
Dnah11 A G 12: 117,974,914 I3273T probably benign Het
Dnhd1 T A 7: 105,714,838 D4132E probably damaging Het
Dst G A 1: 34,191,282 W2327* probably null Het
Epb41 A T 4: 131,982,445 probably benign Het
Frem2 C T 3: 53,652,353 V1578I probably benign Het
Fsip2 A G 2: 82,983,518 T3394A probably benign Het
Gabra5 C T 7: 57,489,010 D97N probably damaging Het
Habp2 A G 19: 56,319,622 E546G probably benign Het
Hace1 A G 10: 45,588,374 probably benign Het
Herc4 T C 10: 63,287,544 S433P probably benign Het
Igf2bp2 T C 16: 22,063,676 N425S probably damaging Het
Krt26 C T 11: 99,335,302 G189S probably damaging Het
Lama2 A T 10: 26,984,376 D3038E probably damaging Het
Lmbrd2 T C 15: 9,151,585 probably benign Het
Lrp1b A G 2: 40,802,984 F3401L possibly damaging Het
Map2k7 T A 8: 4,247,663 S421R possibly damaging Het
Matn1 A G 4: 130,951,947 Q304R possibly damaging Het
Muc4 C T 16: 32,755,273 probably benign Het
Muc5b G A 7: 141,863,630 V3438M probably benign Het
Myo3a A G 2: 22,578,170 R479G possibly damaging Het
Mzf1 A G 7: 13,043,956 V586A possibly damaging Het
Olfr1016 A T 2: 85,799,476 Y265N probably damaging Het
Olfr834 T C 9: 18,988,882 V298A probably benign Het
Pcdhgb7 A T 18: 37,752,363 E195D probably benign Het
Pde4b A G 4: 102,555,625 D199G probably benign Het
Rnf213 C T 11: 119,445,729 Q3309* probably null Het
Setx GTGGCT GT 2: 29,154,061 probably null Het
Slc22a4 C G 11: 53,997,392 C270S probably benign Het
Smarca2 G A 19: 26,683,927 probably null Het
Spata31d1c T C 13: 65,035,399 S252P probably damaging Het
Tyr A G 7: 87,437,940 S455P probably benign Het
Urb1 A T 16: 90,769,465 M1478K probably damaging Het
Usp1 A G 4: 98,934,702 D751G probably damaging Het
Vmn1r214 G A 13: 23,035,350 C338Y probably benign Het
Vmn2r103 A G 17: 19,793,604 I219M possibly damaging Het
Other mutations in Wwp2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01383:Wwp2 APN 8 107533291 critical splice donor site probably null
IGL01411:Wwp2 APN 8 107506345 missense probably benign 0.07
IGL01503:Wwp2 APN 8 107549781 missense probably damaging 0.97
IGL01543:Wwp2 APN 8 107483368 missense probably damaging 1.00
IGL01998:Wwp2 APN 8 107549521 missense probably damaging 1.00
IGL02020:Wwp2 APN 8 107556495 missense probably damaging 1.00
IGL02089:Wwp2 APN 8 107554057 missense probably damaging 1.00
IGL02131:Wwp2 APN 8 107552318 missense probably damaging 0.99
IGL02352:Wwp2 APN 8 107540646 nonsense probably null
IGL02359:Wwp2 APN 8 107540646 nonsense probably null
IGL02419:Wwp2 APN 8 107549815 missense probably damaging 1.00
IGL02528:Wwp2 APN 8 107554467 missense probably benign 0.06
R0639:Wwp2 UTSW 8 107517946 missense probably benign 0.01
R0834:Wwp2 UTSW 8 107556796 splice site probably benign
R1573:Wwp2 UTSW 8 107548489 missense probably damaging 1.00
R1653:Wwp2 UTSW 8 107483410 missense possibly damaging 0.49
R1782:Wwp2 UTSW 8 107506399 frame shift probably null
R1941:Wwp2 UTSW 8 107517915 missense probably benign
R2483:Wwp2 UTSW 8 107548535 missense probably damaging 1.00
R4118:Wwp2 UTSW 8 107545459 missense probably benign 0.00
R4402:Wwp2 UTSW 8 107457978 missense probably benign 0.08
R5042:Wwp2 UTSW 8 107548485 missense possibly damaging 0.95
R5117:Wwp2 UTSW 8 107554062 missense possibly damaging 0.86
R5413:Wwp2 UTSW 8 107555078 missense probably damaging 1.00
R6175:Wwp2 UTSW 8 107483407 missense possibly damaging 0.95
R6232:Wwp2 UTSW 8 107506345 missense probably benign 0.03
R6323:Wwp2 UTSW 8 107540671 missense probably damaging 1.00
R6759:Wwp2 UTSW 8 107540682 missense probably damaging 1.00
R6941:Wwp2 UTSW 8 107548502 missense probably damaging 1.00
R7043:Wwp2 UTSW 8 107457900 missense probably benign 0.00
R7109:Wwp2 UTSW 8 107483356 missense probably benign 0.28
R7457:Wwp2 UTSW 8 107517960 missense probably benign 0.05
R8027:Wwp2 UTSW 8 107555477 missense probably damaging 1.00
X0066:Wwp2 UTSW 8 107518023 missense probably benign
Z1088:Wwp2 UTSW 8 107555087 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCTACAGCTGCCAAGTTGTC -3'
(R):5'- AGCAGTCACTGTCAGACACTG -3'

Sequencing Primer
(F):5'- GTCCCATCATGGTGGGTAACTC -3'
(R):5'- ACTGTCAGACACTGCTGCC -3'
Posted On2015-04-29