Incidental Mutation 'R4014:Herc4'
ID311872
Institutional Source Beutler Lab
Gene Symbol Herc4
Ensembl Gene ENSMUSG00000020064
Gene Namehect domain and RLD 4
Synonyms
MMRRC Submission 040951-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.741) question?
Stock #R4014 (G1)
Quality Score225
Status Validated
Chromosome10
Chromosomal Location63243810-63317878 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 63287544 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 433 (S433P)
Ref Sequence ENSEMBL: ENSMUSP00000151886 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020258] [ENSMUST00000219577]
Predicted Effect probably benign
Transcript: ENSMUST00000020258
AA Change: S433P

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000020258
Gene: ENSMUSG00000020064
AA Change: S433P

DomainStartEndE-ValueType
Pfam:RCC1 1 49 5.1e-11 PFAM
Pfam:RCC1_2 36 65 1.2e-9 PFAM
Pfam:RCC1 52 99 7.9e-16 PFAM
Pfam:RCC1_2 86 115 2.8e-11 PFAM
Pfam:RCC1 102 152 7.6e-18 PFAM
Pfam:RCC1_2 139 168 9.9e-14 PFAM
Pfam:RCC1 156 205 2.2e-15 PFAM
Pfam:RCC1_2 194 221 4.9e-10 PFAM
Pfam:RCC1 208 257 3.5e-17 PFAM
Pfam:RCC1 260 309 9.4e-14 PFAM
Pfam:RCC1 313 376 2.7e-8 PFAM
HECTc 720 1049 1.19e-135 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000181342
Predicted Effect noncoding transcript
Transcript: ENSMUST00000218073
Predicted Effect probably benign
Transcript: ENSMUST00000219577
AA Change: S433P

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000220097
Meta Mutation Damage Score 0.0689 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 93.6%
Validation Efficiency 100% (49/49)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] HERC4 belongs to the HERC family of ubiquitin ligases, all of which contain a HECT domain and at least 1 RCC1 (MIM 179710)-like domain (RLD). The 350-amino acid HECT domain is predicted to catalyze the formation of a thioester with ubiquitin before transferring it to a substrate, and the RLD is predicted to act as a guanine nucleotide exchange factor for small G proteins (Hochrainer et al., 2005 [PubMed 15676274]).[supplied by OMIM, Mar 2008]
PHENOTYPE: Mice homozygous for a gene-trapped allele display reduced male fertility associated with a high percentage of angulated sperm tails and impaired sperm motility. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc2 A T 19: 43,823,120 Q1008L probably benign Het
Adgrg7 A G 16: 56,742,288 F562S probably damaging Het
Alms1 T A 6: 85,678,352 N3293K probably benign Het
Cdk20 T A 13: 64,437,505 V201D probably benign Het
Cenpf A G 1: 189,653,159 V2308A probably benign Het
Chek1 T C 9: 36,722,754 probably benign Het
Ciz1 G T 2: 32,374,344 E497D probably damaging Het
Clcn6 A G 4: 148,017,610 F339S probably damaging Het
Dctpp1 G A 7: 127,257,113 R146C probably damaging Het
Dennd5a C T 7: 109,935,481 probably null Het
Dmxl1 G A 18: 49,863,962 V442I probably benign Het
Dmxl2 C A 9: 54,378,709 probably null Het
Dnah11 A G 12: 117,974,914 I3273T probably benign Het
Dnhd1 T A 7: 105,714,838 D4132E probably damaging Het
Dst G A 1: 34,191,282 W2327* probably null Het
Epb41 A T 4: 131,982,445 probably benign Het
Frem2 C T 3: 53,652,353 V1578I probably benign Het
Fsip2 A G 2: 82,983,518 T3394A probably benign Het
Gabra5 C T 7: 57,489,010 D97N probably damaging Het
Habp2 A G 19: 56,319,622 E546G probably benign Het
Hace1 A G 10: 45,588,374 probably benign Het
Igf2bp2 T C 16: 22,063,676 N425S probably damaging Het
Krt26 C T 11: 99,335,302 G189S probably damaging Het
Lama2 A T 10: 26,984,376 D3038E probably damaging Het
Lmbrd2 T C 15: 9,151,585 probably benign Het
Lrp1b A G 2: 40,802,984 F3401L possibly damaging Het
Map2k7 T A 8: 4,247,663 S421R possibly damaging Het
Matn1 A G 4: 130,951,947 Q304R possibly damaging Het
Muc4 C T 16: 32,755,273 probably benign Het
Muc5b G A 7: 141,863,630 V3438M probably benign Het
Myo3a A G 2: 22,578,170 R479G possibly damaging Het
Mzf1 A G 7: 13,043,956 V586A possibly damaging Het
Olfr1016 A T 2: 85,799,476 Y265N probably damaging Het
Olfr834 T C 9: 18,988,882 V298A probably benign Het
Pcdhgb7 A T 18: 37,752,363 E195D probably benign Het
Pde4b A G 4: 102,555,625 D199G probably benign Het
Rnf213 C T 11: 119,445,729 Q3309* probably null Het
Setx GTGGCT GT 2: 29,154,061 probably null Het
Slc22a4 C G 11: 53,997,392 C270S probably benign Het
Smarca2 G A 19: 26,683,927 probably null Het
Spata31d1c T C 13: 65,035,399 S252P probably damaging Het
Tyr A G 7: 87,437,940 S455P probably benign Het
Urb1 A T 16: 90,769,465 M1478K probably damaging Het
Usp1 A G 4: 98,934,702 D751G probably damaging Het
Vmn1r214 G A 13: 23,035,350 C338Y probably benign Het
Vmn2r103 A G 17: 19,793,604 I219M possibly damaging Het
Wwp2 A G 8: 107,485,621 N139S probably benign Het
Other mutations in Herc4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00927:Herc4 APN 10 63273537 missense probably benign 0.01
IGL00977:Herc4 APN 10 63311567 missense probably damaging 1.00
IGL01455:Herc4 APN 10 63286143 critical splice donor site probably null
IGL01615:Herc4 APN 10 63290682 splice site probably benign
IGL01974:Herc4 APN 10 63299241 critical splice donor site probably null
IGL02207:Herc4 APN 10 63299244 splice site probably null
IGL02215:Herc4 APN 10 63273566 missense probably benign
IGL02331:Herc4 APN 10 63264160 missense probably benign
IGL02407:Herc4 APN 10 63306424 missense probably damaging 0.96
IGL02444:Herc4 APN 10 63306433 missense probably benign 0.00
IGL02498:Herc4 APN 10 63273465 missense probably benign 0.01
IGL02797:Herc4 APN 10 63316807 splice site probably null
IGL02804:Herc4 APN 10 63285675 missense probably benign 0.10
Boosted UTSW 10 63264171 nonsense probably null
handout UTSW 10 63315658 critical splice acceptor site probably null
R0499:Herc4 UTSW 10 63264032 missense probably damaging 1.00
R0655:Herc4 UTSW 10 63273571 missense probably benign 0.33
R0722:Herc4 UTSW 10 63286065 missense probably null 0.56
R0738:Herc4 UTSW 10 63289149 missense possibly damaging 0.93
R1742:Herc4 UTSW 10 63287949 missense probably benign 0.16
R1776:Herc4 UTSW 10 63264171 nonsense probably null
R1792:Herc4 UTSW 10 63245901 start codon destroyed probably null 1.00
R1968:Herc4 UTSW 10 63273525 missense probably benign 0.43
R1992:Herc4 UTSW 10 63245964 missense possibly damaging 0.50
R2012:Herc4 UTSW 10 63244038 start gained probably benign
R2077:Herc4 UTSW 10 63264053 missense probably benign 0.04
R2103:Herc4 UTSW 10 63246110 missense probably benign 0.00
R2363:Herc4 UTSW 10 63315694 missense possibly damaging 0.96
R3833:Herc4 UTSW 10 63245960 missense probably benign
R4084:Herc4 UTSW 10 63283237 missense probably damaging 1.00
R4855:Herc4 UTSW 10 63315658 critical splice acceptor site probably null
R4883:Herc4 UTSW 10 63285654 missense probably benign 0.00
R5215:Herc4 UTSW 10 63289097 missense probably benign 0.22
R5330:Herc4 UTSW 10 63307799 nonsense probably null
R5331:Herc4 UTSW 10 63307799 nonsense probably null
R5429:Herc4 UTSW 10 63275013 missense probably benign 0.01
R6058:Herc4 UTSW 10 63275042 missense possibly damaging 0.80
R6462:Herc4 UTSW 10 63289101 missense probably benign
R6502:Herc4 UTSW 10 63317418 missense probably benign 0.00
R6669:Herc4 UTSW 10 63286068 missense probably benign 0.00
R7161:Herc4 UTSW 10 63308415 missense probably benign 0.35
R7267:Herc4 UTSW 10 63273586 missense possibly damaging 0.64
R7740:Herc4 UTSW 10 63269678 missense probably benign 0.02
Z1176:Herc4 UTSW 10 63307749 missense not run
Predicted Primers PCR Primer
(F):5'- AGCAGTCACTAAGTCATCGC -3'
(R):5'- AGCAATGAGGGGTTGTCTC -3'

Sequencing Primer
(F):5'- CATAACTCTGTAGCATAGGTTGGCC -3'
(R):5'- GGGGTTGTCTCATCAAAGTACAC -3'
Posted On2015-04-29