Incidental Mutation 'R4014:Vmn1r214'
ID311877
Institutional Source Beutler Lab
Gene Symbol Vmn1r214
Ensembl Gene ENSMUSG00000061829
Gene Namevomeronasal 1 receptor 214
SynonymsV1rh5
MMRRC Submission 040951-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.060) question?
Stock #R4014 (G1)
Quality Score225
Status Validated
Chromosome13
Chromosomal Location23030418-23037957 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 23035350 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Tyrosine at position 338 (C338Y)
Ref Sequence ENSEMBL: ENSMUSP00000153823 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000074252] [ENSMUST00000227236] [ENSMUST00000227652]
Predicted Effect probably benign
Transcript: ENSMUST00000074252
AA Change: C338Y

PolyPhen 2 Score 0.207 (Sensitivity: 0.92; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000073868
Gene: ENSMUSG00000061829
AA Change: C338Y

DomainStartEndE-ValueType
transmembrane domain 17 39 N/A INTRINSIC
Pfam:TAS2R 42 346 7.5e-9 PFAM
Pfam:V1R 75 337 5.3e-32 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000227236
AA Change: C338Y

PolyPhen 2 Score 0.207 (Sensitivity: 0.92; Specificity: 0.88)
Predicted Effect probably benign
Transcript: ENSMUST00000227652
AA Change: C338Y

PolyPhen 2 Score 0.207 (Sensitivity: 0.92; Specificity: 0.88)
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 93.6%
Validation Efficiency 100% (49/49)
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc2 A T 19: 43,823,120 Q1008L probably benign Het
Adgrg7 A G 16: 56,742,288 F562S probably damaging Het
Alms1 T A 6: 85,678,352 N3293K probably benign Het
Cdk20 T A 13: 64,437,505 V201D probably benign Het
Cenpf A G 1: 189,653,159 V2308A probably benign Het
Chek1 T C 9: 36,722,754 probably benign Het
Ciz1 G T 2: 32,374,344 E497D probably damaging Het
Clcn6 A G 4: 148,017,610 F339S probably damaging Het
Dctpp1 G A 7: 127,257,113 R146C probably damaging Het
Dennd5a C T 7: 109,935,481 probably null Het
Dmxl1 G A 18: 49,863,962 V442I probably benign Het
Dmxl2 C A 9: 54,378,709 probably null Het
Dnah11 A G 12: 117,974,914 I3273T probably benign Het
Dnhd1 T A 7: 105,714,838 D4132E probably damaging Het
Dst G A 1: 34,191,282 W2327* probably null Het
Epb41 A T 4: 131,982,445 probably benign Het
Frem2 C T 3: 53,652,353 V1578I probably benign Het
Fsip2 A G 2: 82,983,518 T3394A probably benign Het
Gabra5 C T 7: 57,489,010 D97N probably damaging Het
Habp2 A G 19: 56,319,622 E546G probably benign Het
Hace1 A G 10: 45,588,374 probably benign Het
Herc4 T C 10: 63,287,544 S433P probably benign Het
Igf2bp2 T C 16: 22,063,676 N425S probably damaging Het
Krt26 C T 11: 99,335,302 G189S probably damaging Het
Lama2 A T 10: 26,984,376 D3038E probably damaging Het
Lmbrd2 T C 15: 9,151,585 probably benign Het
Lrp1b A G 2: 40,802,984 F3401L possibly damaging Het
Map2k7 T A 8: 4,247,663 S421R possibly damaging Het
Matn1 A G 4: 130,951,947 Q304R possibly damaging Het
Muc4 C T 16: 32,755,273 probably benign Het
Muc5b G A 7: 141,863,630 V3438M probably benign Het
Myo3a A G 2: 22,578,170 R479G possibly damaging Het
Mzf1 A G 7: 13,043,956 V586A possibly damaging Het
Olfr1016 A T 2: 85,799,476 Y265N probably damaging Het
Olfr834 T C 9: 18,988,882 V298A probably benign Het
Pcdhgb7 A T 18: 37,752,363 E195D probably benign Het
Pde4b A G 4: 102,555,625 D199G probably benign Het
Rnf213 C T 11: 119,445,729 Q3309* probably null Het
Setx GTGGCT GT 2: 29,154,061 probably null Het
Slc22a4 C G 11: 53,997,392 C270S probably benign Het
Smarca2 G A 19: 26,683,927 probably null Het
Spata31d1c T C 13: 65,035,399 S252P probably damaging Het
Tyr A G 7: 87,437,940 S455P probably benign Het
Urb1 A T 16: 90,769,465 M1478K probably damaging Het
Usp1 A G 4: 98,934,702 D751G probably damaging Het
Vmn2r103 A G 17: 19,793,604 I219M possibly damaging Het
Wwp2 A G 8: 107,485,621 N139S probably benign Het
Other mutations in Vmn1r214
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01072:Vmn1r214 APN 13 23035130 missense possibly damaging 0.58
IGL01759:Vmn1r214 APN 13 23034492 missense probably benign 0.00
IGL02000:Vmn1r214 APN 13 23035100 missense possibly damaging 0.90
R0115:Vmn1r214 UTSW 13 23035294 nonsense probably null
R0468:Vmn1r214 UTSW 13 23035253 missense probably benign 0.04
R0481:Vmn1r214 UTSW 13 23035294 nonsense probably null
R0574:Vmn1r214 UTSW 13 23034493 missense probably benign 0.19
R0686:Vmn1r214 UTSW 13 23034792 missense probably damaging 1.00
R1931:Vmn1r214 UTSW 13 23035324 missense possibly damaging 0.46
R3893:Vmn1r214 UTSW 13 23034641 missense probably benign 0.00
R4013:Vmn1r214 UTSW 13 23035350 missense probably benign 0.21
R4015:Vmn1r214 UTSW 13 23035350 missense probably benign 0.21
R4670:Vmn1r214 UTSW 13 23034971 missense probably benign 0.01
R5091:Vmn1r214 UTSW 13 23035401 missense possibly damaging 0.46
R5817:Vmn1r214 UTSW 13 23035321 missense probably damaging 0.98
R6504:Vmn1r214 UTSW 13 23035440 makesense probably null
R7096:Vmn1r214 UTSW 13 23035026 missense probably damaging 1.00
R7141:Vmn1r214 UTSW 13 23034669 missense probably benign 0.41
R7293:Vmn1r214 UTSW 13 23034669 missense probably benign 0.41
R7759:Vmn1r214 UTSW 13 23034461 missense not run
X0002:Vmn1r214 UTSW 13 23034801 missense probably damaging 0.98
Z1176:Vmn1r214 UTSW 13 23034495 missense possibly damaging 0.87
Predicted Primers PCR Primer
(F):5'- AGAACTCCAAGCTTCTCTACAG -3'
(R):5'- TAACCTCAGTGCAAGGCTTG -3'

Sequencing Primer
(F):5'- AGAACTCCCCCTGAGCTGAGAG -3'
(R):5'- CCTCAGTGCAAGGCTTGAGTAAC -3'
Posted On2015-04-29