Incidental Mutation 'R4014:Spata31d1c'
ID311879
Institutional Source Beutler Lab
Gene Symbol Spata31d1c
Ensembl Gene ENSMUSG00000074849
Gene Namespermatogenesis associated 31 subfamily D, member 1C
Synonyms4932441B19Rik, Fam75d1c
MMRRC Submission 040951-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4014 (G1)
Quality Score225
Status Validated
Chromosome13
Chromosomal Location65033058-65038004 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 65035399 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 252 (S252P)
Ref Sequence ENSEMBL: ENSMUSP00000097024 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099427]
Predicted Effect probably damaging
Transcript: ENSMUST00000099427
AA Change: S252P

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000097024
Gene: ENSMUSG00000074849
AA Change: S252P

DomainStartEndE-ValueType
transmembrane domain 22 44 N/A INTRINSIC
Pfam:DUF4599 63 148 2.4e-31 PFAM
low complexity region 178 190 N/A INTRINSIC
low complexity region 196 213 N/A INTRINSIC
low complexity region 218 233 N/A INTRINSIC
low complexity region 237 251 N/A INTRINSIC
Pfam:FAM75 380 742 1.4e-120 PFAM
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 93.6%
Validation Efficiency 100% (49/49)
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc2 A T 19: 43,823,120 Q1008L probably benign Het
Adgrg7 A G 16: 56,742,288 F562S probably damaging Het
Alms1 T A 6: 85,678,352 N3293K probably benign Het
Cdk20 T A 13: 64,437,505 V201D probably benign Het
Cenpf A G 1: 189,653,159 V2308A probably benign Het
Chek1 T C 9: 36,722,754 probably benign Het
Ciz1 G T 2: 32,374,344 E497D probably damaging Het
Clcn6 A G 4: 148,017,610 F339S probably damaging Het
Dctpp1 G A 7: 127,257,113 R146C probably damaging Het
Dennd5a C T 7: 109,935,481 probably null Het
Dmxl1 G A 18: 49,863,962 V442I probably benign Het
Dmxl2 C A 9: 54,378,709 probably null Het
Dnah11 A G 12: 117,974,914 I3273T probably benign Het
Dnhd1 T A 7: 105,714,838 D4132E probably damaging Het
Dst G A 1: 34,191,282 W2327* probably null Het
Epb41 A T 4: 131,982,445 probably benign Het
Frem2 C T 3: 53,652,353 V1578I probably benign Het
Fsip2 A G 2: 82,983,518 T3394A probably benign Het
Gabra5 C T 7: 57,489,010 D97N probably damaging Het
Habp2 A G 19: 56,319,622 E546G probably benign Het
Hace1 A G 10: 45,588,374 probably benign Het
Herc4 T C 10: 63,287,544 S433P probably benign Het
Igf2bp2 T C 16: 22,063,676 N425S probably damaging Het
Krt26 C T 11: 99,335,302 G189S probably damaging Het
Lama2 A T 10: 26,984,376 D3038E probably damaging Het
Lmbrd2 T C 15: 9,151,585 probably benign Het
Lrp1b A G 2: 40,802,984 F3401L possibly damaging Het
Map2k7 T A 8: 4,247,663 S421R possibly damaging Het
Matn1 A G 4: 130,951,947 Q304R possibly damaging Het
Muc4 C T 16: 32,755,273 probably benign Het
Muc5b G A 7: 141,863,630 V3438M probably benign Het
Myo3a A G 2: 22,578,170 R479G possibly damaging Het
Mzf1 A G 7: 13,043,956 V586A possibly damaging Het
Olfr1016 A T 2: 85,799,476 Y265N probably damaging Het
Olfr834 T C 9: 18,988,882 V298A probably benign Het
Pcdhgb7 A T 18: 37,752,363 E195D probably benign Het
Pde4b A G 4: 102,555,625 D199G probably benign Het
Rnf213 C T 11: 119,445,729 Q3309* probably null Het
Setx GTGGCT GT 2: 29,154,061 probably null Het
Slc22a4 C G 11: 53,997,392 C270S probably benign Het
Smarca2 G A 19: 26,683,927 probably null Het
Tyr A G 7: 87,437,940 S455P probably benign Het
Urb1 A T 16: 90,769,465 M1478K probably damaging Het
Usp1 A G 4: 98,934,702 D751G probably damaging Het
Vmn1r214 G A 13: 23,035,350 C338Y probably benign Het
Vmn2r103 A G 17: 19,793,604 I219M possibly damaging Het
Wwp2 A G 8: 107,485,621 N139S probably benign Het
Other mutations in Spata31d1c
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01639:Spata31d1c APN 13 65036089 missense probably damaging 1.00
IGL02830:Spata31d1c APN 13 65035366 missense probably benign 0.25
IGL02947:Spata31d1c APN 13 65034945 nonsense probably null
IGL03133:Spata31d1c APN 13 65034985 missense probably benign 0.18
IGL03176:Spata31d1c APN 13 65037011 missense probably benign 0.01
IGL03183:Spata31d1c APN 13 65035195 missense possibly damaging 0.86
IGL03206:Spata31d1c APN 13 65035593 missense probably benign 0.41
PIT4382001:Spata31d1c UTSW 13 65036171 missense probably benign 0.01
R0054:Spata31d1c UTSW 13 65033062 start gained probably benign
R0959:Spata31d1c UTSW 13 65036315 missense probably damaging 1.00
R1232:Spata31d1c UTSW 13 65036614 missense probably benign
R1347:Spata31d1c UTSW 13 65035388 missense probably benign 0.00
R1381:Spata31d1c UTSW 13 65036554 missense probably benign 0.08
R1573:Spata31d1c UTSW 13 65035069 missense possibly damaging 0.92
R1582:Spata31d1c UTSW 13 65033224 missense probably benign
R1639:Spata31d1c UTSW 13 65036039 missense probably benign
R1716:Spata31d1c UTSW 13 65033216 missense possibly damaging 0.86
R1781:Spata31d1c UTSW 13 65036171 missense probably benign 0.01
R1907:Spata31d1c UTSW 13 65035876 missense probably benign 0.03
R2012:Spata31d1c UTSW 13 65035227 missense possibly damaging 0.91
R2152:Spata31d1c UTSW 13 65033965 critical splice donor site probably null
R2211:Spata31d1c UTSW 13 65035939 missense probably benign 0.04
R2571:Spata31d1c UTSW 13 65036384 missense probably damaging 1.00
R2908:Spata31d1c UTSW 13 65033191 missense possibly damaging 0.63
R3978:Spata31d1c UTSW 13 65035160 missense possibly damaging 0.61
R3979:Spata31d1c UTSW 13 65035160 missense possibly damaging 0.61
R3980:Spata31d1c UTSW 13 65035160 missense possibly damaging 0.61
R3981:Spata31d1c UTSW 13 65035111 missense possibly damaging 0.68
R4255:Spata31d1c UTSW 13 65035688 nonsense probably null
R4255:Spata31d1c UTSW 13 65035717 missense probably benign 0.04
R4592:Spata31d1c UTSW 13 65036060 missense probably damaging 0.99
R4597:Spata31d1c UTSW 13 65035613 nonsense probably null
R4624:Spata31d1c UTSW 13 65036597 missense probably benign
R4641:Spata31d1c UTSW 13 65035048 missense probably benign 0.01
R4863:Spata31d1c UTSW 13 65035790 nonsense probably null
R5084:Spata31d1c UTSW 13 65035130 missense probably damaging 0.98
R5152:Spata31d1c UTSW 13 65035595 missense probably damaging 1.00
R5230:Spata31d1c UTSW 13 65035434 missense probably benign 0.41
R5267:Spata31d1c UTSW 13 65035904 missense probably damaging 0.98
R5615:Spata31d1c UTSW 13 65035264 missense possibly damaging 0.61
R5755:Spata31d1c UTSW 13 65036527 missense probably benign 0.12
R5935:Spata31d1c UTSW 13 65037080 missense possibly damaging 0.68
R6017:Spata31d1c UTSW 13 65035079 missense possibly damaging 0.91
R6131:Spata31d1c UTSW 13 65035671 missense probably benign 0.10
R6359:Spata31d1c UTSW 13 65035592 missense possibly damaging 0.63
R6723:Spata31d1c UTSW 13 65035944 missense probably benign 0.01
R7028:Spata31d1c UTSW 13 65036063 missense probably damaging 0.98
R7336:Spata31d1c UTSW 13 65036128 missense probably damaging 0.99
R7426:Spata31d1c UTSW 13 65035361 missense probably benign
R7552:Spata31d1c UTSW 13 65036123 missense probably damaging 0.98
R7605:Spata31d1c UTSW 13 65035840 missense probably benign 0.00
R7666:Spata31d1c UTSW 13 65036000 missense probably benign 0.01
R8403:Spata31d1c UTSW 13 65036230 missense probably benign 0.42
R8445:Spata31d1c UTSW 13 65033177 missense probably damaging 0.98
R8513:Spata31d1c UTSW 13 65033177 missense probably damaging 0.98
R8515:Spata31d1c UTSW 13 65033177 missense probably damaging 0.98
R8523:Spata31d1c UTSW 13 65033177 missense probably damaging 0.98
R8799:Spata31d1c UTSW 13 65036326 missense possibly damaging 0.92
R8817:Spata31d1c UTSW 13 65034562 missense probably damaging 0.98
R8854:Spata31d1c UTSW 13 65035990 missense possibly damaging 0.82
R8917:Spata31d1c UTSW 13 65035615 missense not run
X0022:Spata31d1c UTSW 13 65036927 missense probably benign 0.35
Predicted Primers PCR Primer
(F):5'- AGTGAGTACCTAGAAGACACACTTTC -3'
(R):5'- GGTTTCCAGGCAATGTGAGG -3'

Sequencing Primer
(F):5'- TAGAAGACACACTTTCTCTCTCAC -3'
(R):5'- AGGTGTTTCCCCATAAGTAGGATTC -3'
Posted On2015-04-29