Incidental Mutation 'R4014:Lmbrd2'
ID311880
Institutional Source Beutler Lab
Gene Symbol Lmbrd2
Ensembl Gene ENSMUSG00000039704
Gene NameLMBR1 domain containing 2
Synonyms9930036E21Rik
MMRRC Submission 040951-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.169) question?
Stock #R4014 (G1)
Quality Score225
Status Validated
Chromosome15
Chromosomal Location9140550-9202483 bp(+) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) T to C at 9151585 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000154020 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000090380] [ENSMUST00000190131] [ENSMUST00000227556]
Predicted Effect probably benign
Transcript: ENSMUST00000090380
SMART Domains Protein: ENSMUSP00000087858
Gene: ENSMUSG00000039704

DomainStartEndE-ValueType
Pfam:LMBR1 8 546 4.2e-192 PFAM
low complexity region 574 598 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000190131
SMART Domains Protein: ENSMUSP00000139997
Gene: ENSMUSG00000054115

DomainStartEndE-ValueType
FBOX 65 105 2.3e-10 SMART
LRR 170 194 5.3e-1 SMART
LRR 195 219 5.3e-2 SMART
LRR 220 245 1.2e-1 SMART
LRR 299 324 1.2e-1 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000190406
Predicted Effect noncoding transcript
Transcript: ENSMUST00000226149
Predicted Effect probably benign
Transcript: ENSMUST00000227556
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 93.6%
Validation Efficiency 100% (49/49)
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc2 A T 19: 43,823,120 Q1008L probably benign Het
Adgrg7 A G 16: 56,742,288 F562S probably damaging Het
Alms1 T A 6: 85,678,352 N3293K probably benign Het
Cdk20 T A 13: 64,437,505 V201D probably benign Het
Cenpf A G 1: 189,653,159 V2308A probably benign Het
Chek1 T C 9: 36,722,754 probably benign Het
Ciz1 G T 2: 32,374,344 E497D probably damaging Het
Clcn6 A G 4: 148,017,610 F339S probably damaging Het
Dctpp1 G A 7: 127,257,113 R146C probably damaging Het
Dennd5a C T 7: 109,935,481 probably null Het
Dmxl1 G A 18: 49,863,962 V442I probably benign Het
Dmxl2 C A 9: 54,378,709 probably null Het
Dnah11 A G 12: 117,974,914 I3273T probably benign Het
Dnhd1 T A 7: 105,714,838 D4132E probably damaging Het
Dst G A 1: 34,191,282 W2327* probably null Het
Epb41 A T 4: 131,982,445 probably benign Het
Frem2 C T 3: 53,652,353 V1578I probably benign Het
Fsip2 A G 2: 82,983,518 T3394A probably benign Het
Gabra5 C T 7: 57,489,010 D97N probably damaging Het
Habp2 A G 19: 56,319,622 E546G probably benign Het
Hace1 A G 10: 45,588,374 probably benign Het
Herc4 T C 10: 63,287,544 S433P probably benign Het
Igf2bp2 T C 16: 22,063,676 N425S probably damaging Het
Krt26 C T 11: 99,335,302 G189S probably damaging Het
Lama2 A T 10: 26,984,376 D3038E probably damaging Het
Lrp1b A G 2: 40,802,984 F3401L possibly damaging Het
Map2k7 T A 8: 4,247,663 S421R possibly damaging Het
Matn1 A G 4: 130,951,947 Q304R possibly damaging Het
Muc4 C T 16: 32,755,273 probably benign Het
Muc5b G A 7: 141,863,630 V3438M probably benign Het
Myo3a A G 2: 22,578,170 R479G possibly damaging Het
Mzf1 A G 7: 13,043,956 V586A possibly damaging Het
Olfr1016 A T 2: 85,799,476 Y265N probably damaging Het
Olfr834 T C 9: 18,988,882 V298A probably benign Het
Pcdhgb7 A T 18: 37,752,363 E195D probably benign Het
Pde4b A G 4: 102,555,625 D199G probably benign Het
Rnf213 C T 11: 119,445,729 Q3309* probably null Het
Setx GTGGCT GT 2: 29,154,061 probably null Het
Slc22a4 C G 11: 53,997,392 C270S probably benign Het
Smarca2 G A 19: 26,683,927 probably null Het
Spata31d1c T C 13: 65,035,399 S252P probably damaging Het
Tyr A G 7: 87,437,940 S455P probably benign Het
Urb1 A T 16: 90,769,465 M1478K probably damaging Het
Usp1 A G 4: 98,934,702 D751G probably damaging Het
Vmn1r214 G A 13: 23,035,350 C338Y probably benign Het
Vmn2r103 A G 17: 19,793,604 I219M possibly damaging Het
Wwp2 A G 8: 107,485,621 N139S probably benign Het
Other mutations in Lmbrd2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00586:Lmbrd2 APN 15 9157295 missense probably damaging 1.00
IGL00864:Lmbrd2 APN 15 9175210 missense probably damaging 1.00
IGL01554:Lmbrd2 APN 15 9165819 missense possibly damaging 0.96
IGL02142:Lmbrd2 APN 15 9186685 missense probably damaging 1.00
IGL02176:Lmbrd2 APN 15 9182574 missense probably damaging 1.00
IGL02293:Lmbrd2 APN 15 9172189 missense probably benign
IGL02692:Lmbrd2 APN 15 9149068 missense possibly damaging 0.94
IGL03101:Lmbrd2 APN 15 9186608 missense probably damaging 1.00
R0102:Lmbrd2 UTSW 15 9183952 missense probably damaging 1.00
R0370:Lmbrd2 UTSW 15 9165852 missense probably damaging 0.97
R0379:Lmbrd2 UTSW 15 9149479 missense probably benign 0.00
R0513:Lmbrd2 UTSW 15 9194729 missense probably damaging 1.00
R1610:Lmbrd2 UTSW 15 9186612 missense probably benign 0.19
R1628:Lmbrd2 UTSW 15 9182506 missense probably damaging 1.00
R1844:Lmbrd2 UTSW 15 9177751 nonsense probably null
R2422:Lmbrd2 UTSW 15 9194765 missense possibly damaging 0.83
R3614:Lmbrd2 UTSW 15 9177711 missense probably damaging 1.00
R3924:Lmbrd2 UTSW 15 9149537 missense probably benign
R4298:Lmbrd2 UTSW 15 9165795 missense possibly damaging 0.92
R5126:Lmbrd2 UTSW 15 9194701 missense possibly damaging 0.91
R5699:Lmbrd2 UTSW 15 9175182 missense probably benign 0.40
R5841:Lmbrd2 UTSW 15 9182570 missense possibly damaging 0.94
R5974:Lmbrd2 UTSW 15 9172115 missense probably benign 0.25
R5988:Lmbrd2 UTSW 15 9182406 splice site probably null
R6179:Lmbrd2 UTSW 15 9149175 missense probably damaging 0.99
R6666:Lmbrd2 UTSW 15 9151569 missense probably benign 0.06
R7180:Lmbrd2 UTSW 15 9175196 missense possibly damaging 0.90
R7269:Lmbrd2 UTSW 15 9194684 missense probably damaging 1.00
R7341:Lmbrd2 UTSW 15 9165819 missense possibly damaging 0.96
R8017:Lmbrd2 UTSW 15 9172230 missense probably benign 0.00
R8066:Lmbrd2 UTSW 15 9172085 missense probably benign 0.35
R8110:Lmbrd2 UTSW 15 9175192 missense probably damaging 1.00
R8393:Lmbrd2 UTSW 15 9178350 missense probably damaging 1.00
R8401:Lmbrd2 UTSW 15 9156207 missense possibly damaging 0.85
Predicted Primers PCR Primer
(F):5'- GGCTTTGTCCTTACATATCCGG -3'
(R):5'- AGGACTGGACTGAAGTTCAAAC -3'

Sequencing Primer
(F):5'- TCCTTACATATCCGGTGTTTGG -3'
(R):5'- CTGGACTGAAGTTCAAACAAGAAAG -3'
Posted On2015-04-29