Mutagenetix > Incidental Mutations

Incidental Mutation 'R0384:Itga2b'

31189

Institutional Source

Beutler Lab

Gene Symbol

Itga2b

Ensembl Gene

ENSMUSG00000034664

Gene Name

integrin alpha 2b

Synonyms

platelet glycoprotein IIb, GpIIb, alphaIIb, GP IIb, CD41

MMRRC Submission

038590-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.212) question?

Stock #

R0384 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

102453297-102470122 bp(-) (GRCm38)

Type of Mutation

splice site

DNA Base Change (assembly)

A to T at 102465362 bp

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000099375 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000103086]

Predicted Effect

probably null
Transcript: ENSMUST00000103086

SMART Domains

Protein: ENSMUSP00000099375
Gene: ENSMUSG00000034664

Domain	Start	End	E-Value	Type
signal peptide	1	31	N/A	INTRINSIC
Int_alpha	46	103	2.34e-10	SMART
Int_alpha	261	311	1.3e-3	SMART
Int_alpha	315	376	4.9e-13	SMART
Int_alpha	382	438	4.34e-14	SMART
Int_alpha	443	494	4.05e-5	SMART
low complexity region	552	567	N/A	INTRINSIC
SCOP:d1m1xa2	635	770	1e-48	SMART
SCOP:d1m1xa3	775	995	3e-66	SMART
Pfam:Integrin_alpha	1015	1029	5.7e-7	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000124767

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000130433

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000130757

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000145925

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000149519

Meta Mutation Damage Score

0.9755

Coding Region Coverage

1x: 99.1%
3x: 98.1%
10x: 95.8%
20x: 91.7%

Validation Efficiency

100% (72/72)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the integrin alpha chain family of proteins. The encoded preproprotein is proteolytically processed to generate light and heavy chains that associate through disulfide linkages to form a subunit of the alpha-IIb/beta-3 integrin cell adhesion receptor. This receptor plays a crucial role in the blood coagulation system, by mediating platelet aggregation. Mutations in this gene are associated with platelet-type bleeding disorders, which are characterized by a failure of platelet aggregation, including Glanzmann thrombasthenia. [provided by RefSeq, Jan 2016]
PHENOTYPE: Homozygotes for targeted null mutations exhibit a bleeding disorder, lack platelet binding to fibrinogen, absence of fibrinogen in platelet alpha granules, and increased numbers of hematopoietic progenitors in yolk sac, fetal liver, and bone marrow. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 69 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adam8	T	A	7: 139,986,812		probably benign	Het
Akr1b8	T	C	6: 34,364,330		probably benign	Het
Arhgef39	A	G	4: 43,498,613	L117P	probably damaging	Het
Atp13a1	A	T	8: 69,797,324	Q356L	possibly damaging	Het
Bmp2k	T	A	5: 97,031,125		probably benign	Het
Ccdc141	A	G	2: 77,027,648	V1063A	probably damaging	Het
Col20a1	T	C	2: 180,999,162	Y568H	probably benign	Het
Crabp2	T	C	3: 87,953,021	V134A	possibly damaging	Het
Cyp19a1	T	C	9: 54,172,741	K265E	probably benign	Het
Cyp2j9	T	C	4: 96,585,885	H106R	probably benign	Het
Dcps	T	C	9: 35,175,943	K9R	probably damaging	Het
Dnajc6	C	T	4: 101,598,956	T47I	probably damaging	Het
Dnhd1	T	G	7: 105,720,114	S4315A	possibly damaging	Het
Dnmt3l	A	T	10: 78,052,737	I158F	possibly damaging	Het
Dock3	A	G	9: 106,901,895		probably benign	Het
Eefsec	A	G	6: 88,281,650		probably null	Het
Fam204a	T	C	19: 60,221,296	M1V	probably null	Het
Fam98b	T	C	2: 117,267,847	V266A	possibly damaging	Het
Fat2	A	T	11: 55,269,465	I3274N	possibly damaging	Het
Fbxo18	A	G	2: 11,749,578	I198T	probably damaging	Het
Fer	T	C	17: 63,924,184		probably benign	Het
Fhad1	T	A	4: 142,002,426	M89L	probably benign	Het
Fjx1	C	A	2: 102,451,107	C161F	probably damaging	Het
Fkbp7	T	A	2: 76,665,824		probably benign	Het
Gm42669	T	A	5: 107,508,798	C976S	probably benign	Het
Gm4845	T	C	1: 141,257,085		noncoding transcript	Het
Herc1	T	A	9: 66,481,050		probably benign	Het
Hook3	C	T	8: 26,044,235		probably null	Het
Idh2	C	T	7: 80,098,257	A232T	probably damaging	Het
Klk1b21	T	C	7: 44,105,493	Y71H	probably benign	Het
Kndc1	A	T	7: 139,910,599	N339I	possibly damaging	Het
Ky	C	T	9: 102,542,090	T432I	probably benign	Het
Map4	C	T	9: 110,034,628	T307I	probably damaging	Het
Matn1	T	C	4: 130,944,476	L18P	probably benign	Het
Mindy4	G	A	6: 55,216,684	D121N	probably damaging	Het
Mpv17l	A	T	16: 13,940,999	I96L	probably benign	Het
Msto1	G	A	3: 88,910,339	Q441*	probably null	Het
Muc5ac	A	G	7: 141,812,251	H2048R	possibly damaging	Het
Musk	T	C	4: 58,373,711	*879Q	probably null	Het
Nat8f2	T	C	6: 85,868,368	Y4C	possibly damaging	Het
Ncaph2	T	A	15: 89,369,391	I282N	probably benign	Het
Nid1	A	G	13: 13,463,836	T114A	probably benign	Het
Npr1	C	A	3: 90,465,167	G113C	probably damaging	Het
Nrxn1	G	A	17: 90,208,347	P193S	probably damaging	Het
Nwd2	T	C	5: 63,805,682	F870L	probably benign	Het
Olfr1076	T	A	2: 86,509,383	I308K	possibly damaging	Het
Olfr1228	A	G	2: 89,249,070	I208T	possibly damaging	Het
Olfr55	A	G	17: 33,176,548	I45V	probably damaging	Het
Olfr787	T	A	10: 129,463,040	Y121*	probably null	Het
Phf14	A	G	6: 11,997,020		probably benign	Het
Pnpla5	G	T	15: 84,120,719	L144M	probably damaging	Het
Prdm2	T	C	4: 143,135,688	E344G	probably benign	Het
Psmd12	T	C	11: 107,485,721	V61A	probably benign	Het
Relt	T	C	7: 100,847,505	D385G	probably benign	Het
Rif1	GCCACCA	GCCA	2: 52,110,324		probably benign	Het
Scg2	T	A	1: 79,435,549	I446F	probably benign	Het
Sema3b	G	A	9: 107,600,966	L407F	probably damaging	Het
Slc25a13	A	T	6: 6,042,600	Y601*	probably null	Het
Sun5	C	T	2: 153,858,965	V270I	probably benign	Het
Tex52	A	G	6: 128,379,533	Y63C	probably damaging	Het
Tmem138	A	G	19: 10,574,822		probably benign	Het
Tnpo3	A	G	6: 29,582,164		probably null	Het
Tspoap1	A	T	11: 87,766,454	Q364L	probably damaging	Het
Ttc41	T	C	10: 86,763,947	L1037P	probably damaging	Het
Ugcg	T	A	4: 59,220,387	D393E	possibly damaging	Het
Vmn1r184	T	C	7: 26,267,651	I274T	probably benign	Het
Vmn2r27	A	G	6: 124,223,912	V362A	probably benign	Het
Vmn2r87	T	A	10: 130,471,843	Y842F	probably benign	Het
Vps8	T	A	16: 21,506,825		probably benign	Het

Other mutations in Itga2b

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01637:Itga2b	APN	11	102455583	missense	probably damaging	1.00
IGL02197:Itga2b	APN	11	102466319	missense	probably benign	0.19
IGL02349:Itga2b	APN	11	102461363	missense	probably damaging	0.98
IGL02711:Itga2b	APN	11	102465725	missense	possibly damaging	0.53
R0282:Itga2b	UTSW	11	102460846	missense	probably damaging	0.99
R0349:Itga2b	UTSW	11	102467426	missense	probably damaging	0.98
R0403:Itga2b	UTSW	11	102467326	critical splice donor site	probably null
R0452:Itga2b	UTSW	11	102465953	intron	probably null
R0535:Itga2b	UTSW	11	102457533	missense	possibly damaging	0.65
R1412:Itga2b	UTSW	11	102457005	missense	probably benign	0.00
R1517:Itga2b	UTSW	11	102466325	nonsense	probably null
R1615:Itga2b	UTSW	11	102460137	critical splice donor site	probably null
R1716:Itga2b	UTSW	11	102460777	missense	probably benign	0.30
R1953:Itga2b	UTSW	11	102458183	missense	probably benign	0.18
R2001:Itga2b	UTSW	11	102467339	missense	probably benign
R2216:Itga2b	UTSW	11	102467866	missense	probably benign	0.35
R4193:Itga2b	UTSW	11	102469685	missense	probably benign	0.01
R4770:Itga2b	UTSW	11	102460756	missense	probably damaging	1.00
R4805:Itga2b	UTSW	11	102467866	missense	probably benign	0.00
R4880:Itga2b	UTSW	11	102457722	intron	probably benign
R4906:Itga2b	UTSW	11	102461159	missense	probably benign	0.43
R5112:Itga2b	UTSW	11	102458191	missense	probably damaging	0.99
R5362:Itga2b	UTSW	11	102461135	missense	probably damaging	0.99
R5739:Itga2b	UTSW	11	102465909	missense	probably benign	0.14
R5761:Itga2b	UTSW	11	102466274	missense	probably benign	0.00
R5840:Itga2b	UTSW	11	102461331	missense	probably damaging	1.00
R5851:Itga2b	UTSW	11	102457601	intron	probably benign
R6239:Itga2b	UTSW	11	102465318	missense	possibly damaging	0.61
R6491:Itga2b	UTSW	11	102459869	splice site	probably null
R7426:Itga2b	UTSW	11	102456294	missense	probably benign	0.01
R7635:Itga2b	UTSW	11	102461756	missense	probably damaging	1.00
R7664:Itga2b	UTSW	11	102460840	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TCTTGGGCACCCTTGGGAAAAGATG -3'
(R):5'- TCACCGCTTAGCATTCCGAACC -3'

Sequencing Primer
(F):5'- AAAGATGGTAACTCCTGCCTCTG -3'
(R):5'- GTGGAAATTTTGGACTCCTACTACC -3'

Posted On

2013-04-24