Incidental Mutation 'R4015:Rbm12b1'
ID311897
Institutional Source Beutler Lab
Gene Symbol Rbm12b1
Ensembl Gene ENSMUSG00000046667
Gene NameRNA binding motif protein 12 B1
Synonyms
MMRRC Submission 040952-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.287) question?
Stock #R4015 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location12140264-12146731 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 12145491 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 488 (S488P)
Ref Sequence ENSEMBL: ENSMUSP00000064195 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000050069] [ENSMUST00000069128]
Predicted Effect probably benign
Transcript: ENSMUST00000050069
AA Change: S488P

PolyPhen 2 Score 0.042 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000053555
Gene: ENSMUSG00000046667
AA Change: S488P

DomainStartEndE-ValueType
RRM 4 72 2.1e-1 SMART
low complexity region 115 125 N/A INTRINSIC
RRM 155 225 5.59e-4 SMART
RRM 284 355 4.87e-4 SMART
RRM 402 474 2.28e-9 SMART
RRM 761 834 1.51e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000069128
AA Change: S488P

PolyPhen 2 Score 0.042 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000064195
Gene: ENSMUSG00000046667
AA Change: S488P

DomainStartEndE-ValueType
RRM 4 72 2.1e-1 SMART
low complexity region 115 125 N/A INTRINSIC
RRM 155 225 5.59e-4 SMART
RRM 284 355 4.87e-4 SMART
RRM 402 474 2.28e-9 SMART
RRM 761 834 1.51e-2 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138008
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146416
Meta Mutation Damage Score 0.0636 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 93.5%
Validation Efficiency 97% (38/39)
Allele List at MGI
Other mutations in this stock
Total: 33 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb6 C T 1: 75,174,491 probably null Het
Cacna1e T C 1: 154,482,585 D580G probably damaging Het
Ccdc66 A G 14: 27,483,836 I898T probably damaging Het
Celf3 T C 3: 94,487,198 V202A probably benign Het
Cfap161 C T 7: 83,780,271 G180S probably benign Het
Col5a2 T C 1: 45,403,471 I605V probably benign Het
Coq6 A G 12: 84,366,897 H67R probably benign Het
Cyp2b19 T C 7: 26,762,343 F196S probably damaging Het
Cyp4a14 G T 4: 115,491,134 P382Q probably damaging Het
Dctpp1 G A 7: 127,257,113 R146C probably damaging Het
Ddias T C 7: 92,859,861 K282R probably benign Het
Dnah10 A G 5: 124,777,926 Q1965R probably benign Het
Gm10608 CAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA CAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA 9: 119,160,716 probably null Het
Igf2bp2 T C 16: 22,063,676 N425S probably damaging Het
Lrp1b A G 2: 40,802,984 F3401L possibly damaging Het
Mocs2 T C 13: 114,820,798 probably benign Het
Muc5b G A 7: 141,863,630 V3438M probably benign Het
Myo3a A G 2: 22,578,170 R479G possibly damaging Het
Nalcn T G 14: 123,486,387 E422A probably damaging Het
Pcdh17 T C 14: 84,447,107 V338A probably damaging Het
Ptch1 T G 13: 63,524,959 E944A probably benign Het
Setx GTGGCT GT 2: 29,154,061 probably null Het
Srcap C A 7: 127,525,423 P255Q probably benign Het
Sult6b2 T A 6: 142,790,262 N202I possibly damaging Het
Tcf7l1 A G 6: 72,636,399 probably benign Het
Tef T C 15: 81,823,605 V261A probably damaging Het
Trio C T 15: 27,744,101 V2582I possibly damaging Het
Tyr A G 7: 87,437,940 S455P probably benign Het
Uggt2 T C 14: 119,026,433 N1062D possibly damaging Het
Unc13b G A 4: 43,237,801 G3441R probably damaging Het
Vmn1r214 G A 13: 23,035,350 C338Y probably benign Het
Wdr70 A T 15: 8,079,214 C149* probably null Het
Zfp867 A G 11: 59,463,694 F270L probably damaging Het
Other mutations in Rbm12b1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00953:Rbm12b1 APN 4 12146038 missense probably damaging 0.99
IGL02103:Rbm12b1 APN 4 12145563 missense probably damaging 0.99
IGL03165:Rbm12b1 APN 4 12145845 missense possibly damaging 0.94
PIT4618001:Rbm12b1 UTSW 4 12145441 missense probably damaging 1.00
R0449:Rbm12b1 UTSW 4 12145507 missense probably benign 0.00
R0528:Rbm12b1 UTSW 4 12145657 missense probably benign 0.00
R0571:Rbm12b1 UTSW 4 12146248 missense probably benign 0.00
R1476:Rbm12b1 UTSW 4 12145817 missense possibly damaging 0.74
R1709:Rbm12b1 UTSW 4 12145827 missense probably benign 0.00
R1759:Rbm12b1 UTSW 4 12145424 missense probably damaging 1.00
R1967:Rbm12b1 UTSW 4 12146304 missense probably benign 0.00
R2055:Rbm12b1 UTSW 4 12145606 missense probably benign 0.05
R2425:Rbm12b1 UTSW 4 12146443 missense probably damaging 0.99
R4332:Rbm12b1 UTSW 4 12145655 missense probably benign 0.02
R5773:Rbm12b1 UTSW 4 12145765 missense probably damaging 1.00
R6497:Rbm12b1 UTSW 4 12146431 missense probably benign 0.00
Z1088:Rbm12b1 UTSW 4 12146079 missense probably benign
Predicted Primers PCR Primer
(F):5'- GCAGAAGTTCTTTGCAGACTTTTCTC -3'
(R):5'- ACTGCCGGAAATACCCTTGG -3'

Sequencing Primer
(F):5'- CAGACTTTTCTCTTGTTGAGGATGAC -3'
(R):5'- GGGATGCTTGAAATGACCCATTTTC -3'
Posted On2015-04-29