Incidental Mutation 'R4015:Cfap161'
ID311905
Institutional Source Beutler Lab
Gene Symbol Cfap161
Ensembl Gene ENSMUSG00000011154
Gene Namecilia and flagella associated protein 161
Synonyms1700026D08Rik
MMRRC Submission 040952-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.069) question?
Stock #R4015 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location83774101-83794880 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 83780271 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Serine at position 180 (G180S)
Ref Sequence ENSEMBL: ENSMUSP00000114051 (fasta)
Predicted Effect probably benign
Transcript: ENSMUST00000011298
AA Change: G180S

PolyPhen 2 Score 0.014 (Sensitivity: 0.96; Specificity: 0.79)
Predicted Effect probably benign
Transcript: ENSMUST00000119134
AA Change: G180S

PolyPhen 2 Score 0.014 (Sensitivity: 0.96; Specificity: 0.79)
Predicted Effect probably benign
Transcript: ENSMUST00000149671
AA Change: G155S

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000208785
Meta Mutation Damage Score 0.1164 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 93.5%
Validation Efficiency 97% (38/39)
Allele List at MGI
Other mutations in this stock
Total: 33 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb6 C T 1: 75,174,491 probably null Het
Cacna1e T C 1: 154,482,585 D580G probably damaging Het
Ccdc66 A G 14: 27,483,836 I898T probably damaging Het
Celf3 T C 3: 94,487,198 V202A probably benign Het
Col5a2 T C 1: 45,403,471 I605V probably benign Het
Coq6 A G 12: 84,366,897 H67R probably benign Het
Cyp2b19 T C 7: 26,762,343 F196S probably damaging Het
Cyp4a14 G T 4: 115,491,134 P382Q probably damaging Het
Dctpp1 G A 7: 127,257,113 R146C probably damaging Het
Ddias T C 7: 92,859,861 K282R probably benign Het
Dnah10 A G 5: 124,777,926 Q1965R probably benign Het
Gm10608 CAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA CAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA 9: 119,160,716 probably null Het
Igf2bp2 T C 16: 22,063,676 N425S probably damaging Het
Lrp1b A G 2: 40,802,984 F3401L possibly damaging Het
Mocs2 T C 13: 114,820,798 probably benign Het
Muc5b G A 7: 141,863,630 V3438M probably benign Het
Myo3a A G 2: 22,578,170 R479G possibly damaging Het
Nalcn T G 14: 123,486,387 E422A probably damaging Het
Pcdh17 T C 14: 84,447,107 V338A probably damaging Het
Ptch1 T G 13: 63,524,959 E944A probably benign Het
Rbm12b1 T C 4: 12,145,491 S488P probably benign Het
Setx GTGGCT GT 2: 29,154,061 probably null Het
Srcap C A 7: 127,525,423 P255Q probably benign Het
Sult6b2 T A 6: 142,790,262 N202I possibly damaging Het
Tcf7l1 A G 6: 72,636,399 probably benign Het
Tef T C 15: 81,823,605 V261A probably damaging Het
Trio C T 15: 27,744,101 V2582I possibly damaging Het
Tyr A G 7: 87,437,940 S455P probably benign Het
Uggt2 T C 14: 119,026,433 N1062D possibly damaging Het
Unc13b G A 4: 43,237,801 G3441R probably damaging Het
Vmn1r214 G A 13: 23,035,350 C338Y probably benign Het
Wdr70 A T 15: 8,079,214 C149* probably null Het
Zfp867 A G 11: 59,463,694 F270L probably damaging Het
Other mutations in Cfap161
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01827:Cfap161 APN 7 83793440 missense possibly damaging 0.86
IGL01999:Cfap161 APN 7 83791691 missense probably damaging 1.00
IGL02291:Cfap161 APN 7 83791639 missense probably benign 0.01
IGL02444:Cfap161 APN 7 83776145 missense probably damaging 1.00
R0492:Cfap161 UTSW 7 83794037 missense possibly damaging 0.90
R0652:Cfap161 UTSW 7 83793276 missense probably null 0.01
R1599:Cfap161 UTSW 7 83776079 missense possibly damaging 0.84
R1828:Cfap161 UTSW 7 83791724 critical splice acceptor site probably null
R2117:Cfap161 UTSW 7 83775976 missense possibly damaging 0.63
R2262:Cfap161 UTSW 7 83793372 missense probably benign 0.37
R3618:Cfap161 UTSW 7 83780182 nonsense probably null
R5821:Cfap161 UTSW 7 83775980 missense probably benign 0.38
R6477:Cfap161 UTSW 7 83794022 nonsense probably null
R6478:Cfap161 UTSW 7 83793276 missense probably benign 0.00
R7108:Cfap161 UTSW 7 83793310 missense possibly damaging 0.60
R7203:Cfap161 UTSW 7 83776050 missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- TTGGAGCTACAGTGAGCCTCTG -3'
(R):5'- ACATATTCCTGTGAGCTGTGC -3'

Sequencing Primer
(F):5'- CTTGACTGGCAGCTGTGAGC -3'
(R):5'- CTTTCTCATAGGATGGGTAGGAACAG -3'
Posted On2015-04-29