Incidental Mutation 'R4015:Vmn1r214'
ID311915
Institutional Source Beutler Lab
Gene Symbol Vmn1r214
Ensembl Gene ENSMUSG00000061829
Gene Namevomeronasal 1 receptor 214
SynonymsV1rh5
MMRRC Submission 040952-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.060) question?
Stock #R4015 (G1)
Quality Score225
Status Validated
Chromosome13
Chromosomal Location23030418-23037957 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 23035350 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Tyrosine at position 338 (C338Y)
Ref Sequence ENSEMBL: ENSMUSP00000153823 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000074252] [ENSMUST00000227236] [ENSMUST00000227652]
Predicted Effect probably benign
Transcript: ENSMUST00000074252
AA Change: C338Y

PolyPhen 2 Score 0.207 (Sensitivity: 0.92; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000073868
Gene: ENSMUSG00000061829
AA Change: C338Y

DomainStartEndE-ValueType
transmembrane domain 17 39 N/A INTRINSIC
Pfam:TAS2R 42 346 7.5e-9 PFAM
Pfam:V1R 75 337 5.3e-32 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000227236
AA Change: C338Y

PolyPhen 2 Score 0.207 (Sensitivity: 0.92; Specificity: 0.88)
Predicted Effect probably benign
Transcript: ENSMUST00000227652
AA Change: C338Y

PolyPhen 2 Score 0.207 (Sensitivity: 0.92; Specificity: 0.88)
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 93.5%
Validation Efficiency 97% (38/39)
Allele List at MGI
Other mutations in this stock
Total: 33 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb6 C T 1: 75,174,491 probably null Het
Cacna1e T C 1: 154,482,585 D580G probably damaging Het
Ccdc66 A G 14: 27,483,836 I898T probably damaging Het
Celf3 T C 3: 94,487,198 V202A probably benign Het
Cfap161 C T 7: 83,780,271 G180S probably benign Het
Col5a2 T C 1: 45,403,471 I605V probably benign Het
Coq6 A G 12: 84,366,897 H67R probably benign Het
Cyp2b19 T C 7: 26,762,343 F196S probably damaging Het
Cyp4a14 G T 4: 115,491,134 P382Q probably damaging Het
Dctpp1 G A 7: 127,257,113 R146C probably damaging Het
Ddias T C 7: 92,859,861 K282R probably benign Het
Dnah10 A G 5: 124,777,926 Q1965R probably benign Het
Gm10608 CAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA CAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA 9: 119,160,716 probably null Het
Igf2bp2 T C 16: 22,063,676 N425S probably damaging Het
Lrp1b A G 2: 40,802,984 F3401L possibly damaging Het
Mocs2 T C 13: 114,820,798 probably benign Het
Muc5b G A 7: 141,863,630 V3438M probably benign Het
Myo3a A G 2: 22,578,170 R479G possibly damaging Het
Nalcn T G 14: 123,486,387 E422A probably damaging Het
Pcdh17 T C 14: 84,447,107 V338A probably damaging Het
Ptch1 T G 13: 63,524,959 E944A probably benign Het
Rbm12b1 T C 4: 12,145,491 S488P probably benign Het
Setx GTGGCT GT 2: 29,154,061 probably null Het
Srcap C A 7: 127,525,423 P255Q probably benign Het
Sult6b2 T A 6: 142,790,262 N202I possibly damaging Het
Tcf7l1 A G 6: 72,636,399 probably benign Het
Tef T C 15: 81,823,605 V261A probably damaging Het
Trio C T 15: 27,744,101 V2582I possibly damaging Het
Tyr A G 7: 87,437,940 S455P probably benign Het
Uggt2 T C 14: 119,026,433 N1062D possibly damaging Het
Unc13b G A 4: 43,237,801 G3441R probably damaging Het
Wdr70 A T 15: 8,079,214 C149* probably null Het
Zfp867 A G 11: 59,463,694 F270L probably damaging Het
Other mutations in Vmn1r214
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01072:Vmn1r214 APN 13 23035130 missense possibly damaging 0.58
IGL01759:Vmn1r214 APN 13 23034492 missense probably benign 0.00
IGL02000:Vmn1r214 APN 13 23035100 missense possibly damaging 0.90
R0115:Vmn1r214 UTSW 13 23035294 nonsense probably null
R0468:Vmn1r214 UTSW 13 23035253 missense probably benign 0.04
R0481:Vmn1r214 UTSW 13 23035294 nonsense probably null
R0574:Vmn1r214 UTSW 13 23034493 missense probably benign 0.19
R0686:Vmn1r214 UTSW 13 23034792 missense probably damaging 1.00
R1931:Vmn1r214 UTSW 13 23035324 missense possibly damaging 0.46
R3893:Vmn1r214 UTSW 13 23034641 missense probably benign 0.00
R4013:Vmn1r214 UTSW 13 23035350 missense probably benign 0.21
R4014:Vmn1r214 UTSW 13 23035350 missense probably benign 0.21
R4670:Vmn1r214 UTSW 13 23034971 missense probably benign 0.01
R5091:Vmn1r214 UTSW 13 23035401 missense possibly damaging 0.46
R5817:Vmn1r214 UTSW 13 23035321 missense probably damaging 0.98
R6504:Vmn1r214 UTSW 13 23035440 makesense probably null
R7096:Vmn1r214 UTSW 13 23035026 missense probably damaging 1.00
R7141:Vmn1r214 UTSW 13 23034669 missense probably benign 0.41
R7293:Vmn1r214 UTSW 13 23034669 missense probably benign 0.41
R7759:Vmn1r214 UTSW 13 23034461 missense not run
X0002:Vmn1r214 UTSW 13 23034801 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- TCCAAGCTTCTCTACAGAACTC -3'
(R):5'- TAACCTCAGTGCAAGGCTTG -3'

Sequencing Primer
(F):5'- AGAACTCCCCCTGAGCTGAGAG -3'
(R):5'- CCTCAGTGCAAGGCTTGAGTAAC -3'
Posted On2015-04-29