Incidental Mutation 'R4015:Ccdc66'
ID311918
Institutional Source Beutler Lab
Gene Symbol Ccdc66
Ensembl Gene ENSMUSG00000046753
Gene Namecoiled-coil domain containing 66
SynonymsE230015L20Rik
MMRRC Submission 040952-MU
Accession Numbers

Genbank: NM_177111.3; Ensembl: ENSMUST00000050480

Is this an essential gene? Probably non essential (E-score: 0.132) question?
Stock #R4015 (G1)
Quality Score225
Status Validated
Chromosome14
Chromosomal Location27481090-27508460 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 27483836 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 898 (I898T)
Ref Sequence ENSEMBL: ENSMUSP00000153023 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022450] [ENSMUST00000050480] [ENSMUST00000223689]
Predicted Effect probably benign
Transcript: ENSMUST00000022450
SMART Domains Protein: ENSMUSP00000022450
Gene: ENSMUSG00000040651

DomainStartEndE-ValueType
low complexity region 20 27 N/A INTRINSIC
low complexity region 42 61 N/A INTRINSIC
low complexity region 74 88 N/A INTRINSIC
Pfam:DUF3715 153 314 1.5e-55 PFAM
low complexity region 442 457 N/A INTRINSIC
low complexity region 1087 1102 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000050480
AA Change: I742T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000052546
Gene: ENSMUSG00000046753
AA Change: I742T

DomainStartEndE-ValueType
coiled coil region 252 284 N/A INTRINSIC
Pfam:CCDC66 409 561 1e-49 PFAM
low complexity region 715 721 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000223689
AA Change: I898T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000224837
Predicted Effect probably benign
Transcript: ENSMUST00000225139
Meta Mutation Damage Score 0.1772 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 93.5%
Validation Efficiency 97% (38/39)
MGI Phenotype PHENOTYPE: Mice homozygous for a null mutation display slowly progressing photoreceptor degeneration. [provided by MGI curators]
Allele List at MGI

All alleles(6) : Gene trapped(6)

Other mutations in this stock
Total: 33 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb6 C T 1: 75,174,491 probably null Het
Cacna1e T C 1: 154,482,585 D580G probably damaging Het
Celf3 T C 3: 94,487,198 V202A probably benign Het
Cfap161 C T 7: 83,780,271 G180S probably benign Het
Col5a2 T C 1: 45,403,471 I605V probably benign Het
Coq6 A G 12: 84,366,897 H67R probably benign Het
Cyp2b19 T C 7: 26,762,343 F196S probably damaging Het
Cyp4a14 G T 4: 115,491,134 P382Q probably damaging Het
Dctpp1 G A 7: 127,257,113 R146C probably damaging Het
Ddias T C 7: 92,859,861 K282R probably benign Het
Dnah10 A G 5: 124,777,926 Q1965R probably benign Het
Gm10608 CAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA CAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA 9: 119,160,716 probably null Het
Igf2bp2 T C 16: 22,063,676 N425S probably damaging Het
Lrp1b A G 2: 40,802,984 F3401L possibly damaging Het
Mocs2 T C 13: 114,820,798 probably benign Het
Muc5b G A 7: 141,863,630 V3438M probably benign Het
Myo3a A G 2: 22,578,170 R479G possibly damaging Het
Nalcn T G 14: 123,486,387 E422A probably damaging Het
Pcdh17 T C 14: 84,447,107 V338A probably damaging Het
Ptch1 T G 13: 63,524,959 E944A probably benign Het
Rbm12b1 T C 4: 12,145,491 S488P probably benign Het
Setx GTGGCT GT 2: 29,154,061 probably null Het
Srcap C A 7: 127,525,423 P255Q probably benign Het
Sult6b2 T A 6: 142,790,262 N202I possibly damaging Het
Tcf7l1 A G 6: 72,636,399 probably benign Het
Tef T C 15: 81,823,605 V261A probably damaging Het
Trio C T 15: 27,744,101 V2582I possibly damaging Het
Tyr A G 7: 87,437,940 S455P probably benign Het
Uggt2 T C 14: 119,026,433 N1062D possibly damaging Het
Unc13b G A 4: 43,237,801 G3441R probably damaging Het
Vmn1r214 G A 13: 23,035,350 C338Y probably benign Het
Wdr70 A T 15: 8,079,214 C149* probably null Het
Zfp867 A G 11: 59,463,694 F270L probably damaging Het
Other mutations in Ccdc66
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00516:Ccdc66 APN 14 27498456 missense probably damaging 1.00
IGL01333:Ccdc66 APN 14 27493315 missense possibly damaging 0.60
IGL01684:Ccdc66 APN 14 27500249 missense possibly damaging 0.66
IGL02327:Ccdc66 APN 14 27493386 missense probably damaging 1.00
IGL02668:Ccdc66 APN 14 27497341 missense possibly damaging 0.94
IGL02698:Ccdc66 APN 14 27490792 nonsense probably null
IGL03293:Ccdc66 APN 14 27490671 missense probably damaging 1.00
1mM(1):Ccdc66 UTSW 14 27498775 missense possibly damaging 0.75
IGL02796:Ccdc66 UTSW 14 27486566 missense possibly damaging 0.93
R0374:Ccdc66 UTSW 14 27498473 missense probably damaging 1.00
R0381:Ccdc66 UTSW 14 27491933 missense probably damaging 1.00
R0498:Ccdc66 UTSW 14 27500240 critical splice donor site probably null
R0831:Ccdc66 UTSW 14 27497356 missense probably benign 0.00
R0969:Ccdc66 UTSW 14 27497362 missense probably damaging 0.98
R1558:Ccdc66 UTSW 14 27486506 missense probably benign 0.41
R2203:Ccdc66 UTSW 14 27486833 missense probably benign 0.03
R4225:Ccdc66 UTSW 14 27490779 missense probably damaging 1.00
R4584:Ccdc66 UTSW 14 27500511 missense probably benign 0.31
R4600:Ccdc66 UTSW 14 27500420 missense probably damaging 1.00
R4601:Ccdc66 UTSW 14 27500420 missense probably damaging 1.00
R4603:Ccdc66 UTSW 14 27500420 missense probably damaging 1.00
R4610:Ccdc66 UTSW 14 27500420 missense probably damaging 1.00
R4611:Ccdc66 UTSW 14 27500420 missense probably damaging 1.00
R4832:Ccdc66 UTSW 14 27500567 missense probably benign 0.00
R5098:Ccdc66 UTSW 14 27498793 missense probably damaging 1.00
R5322:Ccdc66 UTSW 14 27482527 missense probably damaging 1.00
R5586:Ccdc66 UTSW 14 27506711 missense probably damaging 1.00
R5681:Ccdc66 UTSW 14 27486741 missense probably benign 0.07
R5788:Ccdc66 UTSW 14 27498491 missense probably benign 0.10
R5790:Ccdc66 UTSW 14 27500447 missense possibly damaging 0.62
R6329:Ccdc66 UTSW 14 27486484 missense probably benign 0.20
R7171:Ccdc66 UTSW 14 27493272 missense possibly damaging 0.94
R7268:Ccdc66 UTSW 14 27486923 missense probably benign 0.24
R7337:Ccdc66 UTSW 14 27500333 missense probably damaging 1.00
R7348:Ccdc66 UTSW 14 27500336 missense probably damaging 1.00
R7552:Ccdc66 UTSW 14 27498863 missense possibly damaging 0.63
Predicted Primers PCR Primer
(F):5'- ATGCAGCCTGGACTAGGATC -3'
(R):5'- GACCTTCCAACCCTAAATTTGC -3'

Sequencing Primer
(F):5'- GCTTCCCAAATGTTGATTATGCAGG -3'
(R):5'- CCCGAGAACAAGAGCTATT -3'
Posted On2015-04-29