Incidental Mutation 'R4016:Arpc5'
List |< first << previous [record 3 of 39] next >> last >|
ID311928
Institutional Source Beutler Lab
Gene Symbol Arpc5
Ensembl Gene ENSMUSG00000008475
Gene Nameactin related protein 2/3 complex, subunit 5
Synonymsp16-Arc, 5830443F10Rik
MMRRC Submission 040847-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.437) question?
Stock #R4016 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location152766542-152775597 bp(+) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) G to A at 152768856 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000107490 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000077755] [ENSMUST00000097536] [ENSMUST00000111857] [ENSMUST00000111859]
Predicted Effect probably benign
Transcript: ENSMUST00000077755
SMART Domains Protein: ENSMUSP00000076933
Gene: ENSMUSG00000008475

DomainStartEndE-ValueType
Pfam:P16-Arc 10 151 1.9e-64 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000097536
SMART Domains Protein: ENSMUSP00000095143
Gene: ENSMUSG00000008475

DomainStartEndE-ValueType
Pfam:P16-Arc 9 77 1.4e-14 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000111857
SMART Domains Protein: ENSMUSP00000107488
Gene: ENSMUSG00000026482

DomainStartEndE-ValueType
RasGEFN 62 194 5.86e-39 SMART
RasGEF 226 500 9.56e-116 SMART
Blast:RasGEF 520 580 7e-8 BLAST
low complexity region 583 594 N/A INTRINSIC
low complexity region 625 635 N/A INTRINSIC
RA 646 733 1.7e-25 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000111859
SMART Domains Protein: ENSMUSP00000107490
Gene: ENSMUSG00000026482

DomainStartEndE-ValueType
RasGEFN 99 231 5.86e-39 SMART
RasGEF 263 537 9.56e-116 SMART
Blast:RasGEF 557 617 6e-8 BLAST
low complexity region 620 631 N/A INTRINSIC
low complexity region 662 672 N/A INTRINSIC
RA 683 770 1.7e-25 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143008
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 93.4%
Validation Efficiency 100% (49/49)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes one of seven subunits of the human Arp2/3 protein complex. The Arp2/3 protein complex has been implicated in the control of actin polymerization in cells and has been conserved through evolution. The exact role of the protein encoded by this gene, the p16 subunit, has yet to be determined. Alternatively spliced transcript variants encoding different isoforms have been observed for this gene. [provided by RefSeq, Jul 2012]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aldh8a1 G A 10: 21,395,571 V399I probably benign Het
Apold1 A G 6: 134,983,906 I108V probably benign Het
Capn11 T A 17: 45,653,756 D45V probably damaging Het
Dctpp1 G A 7: 127,257,113 R146C probably damaging Het
Dlat C T 9: 50,649,631 probably null Het
Dock10 T A 1: 80,606,569 D140V probably damaging Het
Dtx3 A G 10: 127,191,171 V378A probably benign Het
Ezh2 A G 6: 47,544,582 I414T probably benign Het
Gm1979 C T 5: 26,004,606 W41* probably null Het
Igf2bp2 T C 16: 22,063,676 N425S probably damaging Het
Kdm5a T A 6: 120,394,106 Y504N probably damaging Het
Map3k21 T A 8: 125,911,185 I170N probably damaging Het
Mrgpra6 C A 7: 47,188,715 C245F possibly damaging Het
Nipal2 T G 15: 34,600,061 K203N possibly damaging Het
Nlrp1b A G 11: 71,173,085 F621S probably damaging Het
Nos3 G A 5: 24,371,716 V448M probably damaging Het
Ntrk3 G T 7: 78,462,947 probably benign Het
Olfr1474 A T 19: 13,471,197 T76S possibly damaging Het
P2rx1 T C 11: 73,009,973 C190R probably damaging Het
Pdzrn4 T A 15: 92,399,749 D198E probably benign Het
Ptar1 A G 19: 23,687,460 M1V probably null Het
Ptch1 T G 13: 63,524,959 E944A probably benign Het
Purg T A 8: 33,386,991 L219* probably null Het
Rbp3 G T 14: 33,955,390 V432L possibly damaging Het
Scnn1b G T 7: 121,914,332 probably null Het
Sgms1 A G 19: 32,142,792 V238A possibly damaging Het
Slc16a14 G T 1: 84,912,507 S359* probably null Het
Smarca2 G A 19: 26,683,927 probably null Het
Spatc1l A G 10: 76,562,489 S42G probably benign Het
Stra6 T A 9: 58,135,190 V34E probably damaging Het
Tex14 A G 11: 87,538,623 probably null Het
Tox4 T C 14: 52,285,904 probably null Het
Tyr A G 7: 87,437,940 S455P probably benign Het
Uggt2 T C 14: 119,026,433 N1062D possibly damaging Het
Umod A C 7: 119,476,690 N284K possibly damaging Het
Unc93b1 T C 19: 3,943,572 I338T probably damaging Het
Vmn2r99 C T 17: 19,378,570 T172I possibly damaging Het
Whrn G A 4: 63,415,639 Q415* probably null Het
Other mutations in Arpc5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00233:Arpc5 APN 1 152768907 missense probably benign 0.10
R4133:Arpc5 UTSW 1 152768871 missense probably benign 0.06
R6307:Arpc5 UTSW 1 152771455 missense possibly damaging 0.49
R7439:Arpc5 UTSW 1 152771436 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- AGAACTGAGGTCAAAACAGTCTTTG -3'
(R):5'- TCTTGTGTCAAGGACAGGAAATAGG -3'

Sequencing Primer
(F):5'- TGTGGGAAACACACCCAT -3'
(R):5'- AATAGGTACAATGTTGACTGTGGG -3'
Posted On2015-04-29