Incidental Mutation 'R4016:Ezh2'
ID311932
Institutional Source Beutler Lab
Gene Symbol Ezh2
Ensembl Gene ENSMUSG00000029687
Gene Nameenhancer of zeste 2 polycomb repressive complex 2 subunit
SynonymsEnx-1, KMT6, Enx1h
MMRRC Submission 040847-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4016 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location47530139-47595341 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 47544582 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 414 (I414T)
Ref Sequence ENSEMBL: ENSMUSP00000110265 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000081721] [ENSMUST00000092648] [ENSMUST00000114616] [ENSMUST00000114618] [ENSMUST00000169889] [ENSMUST00000204798]
Predicted Effect probably benign
Transcript: ENSMUST00000081721
AA Change: I418T

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000080419
Gene: ENSMUSG00000029687
AA Change: I418T

DomainStartEndE-ValueType
Pfam:EZH2_WD-Binding 39 68 6.1e-18 PFAM
SANT 159 250 9.7e-3 SMART
low complexity region 349 366 N/A INTRINSIC
low complexity region 385 409 N/A INTRINSIC
SANT 428 476 6.62e-1 SMART
CXC 555 592 1.05e-1 SMART
SET 612 733 4.15e-38 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000092648
AA Change: I418T

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000090318
Gene: ENSMUSG00000029687
AA Change: I418T

DomainStartEndE-ValueType
Pfam:EZH2_WD-Binding 39 68 6.9e-20 PFAM
SANT 159 250 9.7e-3 SMART
Blast:SET 272 333 3e-13 BLAST
low complexity region 349 366 N/A INTRINSIC
low complexity region 385 409 N/A INTRINSIC
SANT 428 476 6.62e-1 SMART
CXC 513 550 1.05e-1 SMART
SET 570 691 4.15e-38 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000114616
AA Change: I379T

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000110263
Gene: ENSMUSG00000029687
AA Change: I379T

DomainStartEndE-ValueType
Pfam:EZH2_WD-Binding 39 68 2.5e-20 PFAM
SANT 120 211 9.7e-3 SMART
low complexity region 310 327 N/A INTRINSIC
low complexity region 346 370 N/A INTRINSIC
SANT 389 437 6.62e-1 SMART
CXC 516 553 1.05e-1 SMART
SET 573 694 4.15e-38 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000114618
AA Change: I414T

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000110265
Gene: ENSMUSG00000029687
AA Change: I414T

DomainStartEndE-ValueType
Pfam:EZH2_WD-Binding 39 68 7.4e-20 PFAM
SANT 150 241 9.7e-3 SMART
low complexity region 345 362 N/A INTRINSIC
low complexity region 381 405 N/A INTRINSIC
SANT 424 472 6.62e-1 SMART
CXC 551 588 1.05e-1 SMART
SET 608 729 4.15e-38 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000164006
SMART Domains Protein: ENSMUSP00000133195
Gene: ENSMUSG00000029687

DomainStartEndE-ValueType
Blast:SET 2 96 1e-16 BLAST
low complexity region 98 122 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000165492
Predicted Effect probably benign
Transcript: ENSMUST00000167278
SMART Domains Protein: ENSMUSP00000128542
Gene: ENSMUSG00000029687

DomainStartEndE-ValueType
Blast:SET 2 43 6e-9 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000169889
SMART Domains Protein: ENSMUSP00000126481
Gene: ENSMUSG00000029687

DomainStartEndE-ValueType
low complexity region 5 16 N/A INTRINSIC
Blast:SET 18 150 3e-45 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000170311
Predicted Effect noncoding transcript
Transcript: ENSMUST00000181519
Predicted Effect probably benign
Transcript: ENSMUST00000204243
Predicted Effect probably benign
Transcript: ENSMUST00000204798
SMART Domains Protein: ENSMUSP00000144780
Gene: ENSMUSG00000029687

DomainStartEndE-ValueType
Pfam:EZH2_WD-Binding 39 68 4.4e-16 PFAM
Meta Mutation Damage Score 0.0586 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 93.4%
Validation Efficiency 100% (49/49)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the Polycomb-group (PcG) family. PcG family members form multimeric protein complexes, which are involved in maintaining the transcriptional repressive state of genes over successive cell generations. This protein associates with the embryonic ectoderm development protein, the VAV1 oncoprotein, and the X-linked nuclear protein. This protein may play a role in the hematopoietic and central nervous systems. Multiple alternatively splcied transcript variants encoding distinct isoforms have been identified for this gene. [provided by RefSeq, Feb 2011]
PHENOTYPE: Homozygous null mutants die prior to completing gastrulation. A conditional mutant with loss of expression in immune cells survives, but has defects in early B cell development and Igh rearrangement. Conditional loss of maternal protein results in severegrowth retardation of neonates. Conditional loss in oligodendrocytes affects oligodendrocyte maturation and delays subsequent myelinization of axons in the central nervous system by oligodendrocytes. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aldh8a1 G A 10: 21,395,571 V399I probably benign Het
Apold1 A G 6: 134,983,906 I108V probably benign Het
Arpc5 G A 1: 152,768,856 probably benign Het
Capn11 T A 17: 45,653,756 D45V probably damaging Het
Dctpp1 G A 7: 127,257,113 R146C probably damaging Het
Dlat C T 9: 50,649,631 probably null Het
Dock10 T A 1: 80,606,569 D140V probably damaging Het
Dtx3 A G 10: 127,191,171 V378A probably benign Het
Gm1979 C T 5: 26,004,606 W41* probably null Het
Igf2bp2 T C 16: 22,063,676 N425S probably damaging Het
Kdm5a T A 6: 120,394,106 Y504N probably damaging Het
Map3k21 T A 8: 125,911,185 I170N probably damaging Het
Mrgpra6 C A 7: 47,188,715 C245F possibly damaging Het
Nipal2 T G 15: 34,600,061 K203N possibly damaging Het
Nlrp1b A G 11: 71,173,085 F621S probably damaging Het
Nos3 G A 5: 24,371,716 V448M probably damaging Het
Ntrk3 G T 7: 78,462,947 probably benign Het
Olfr1474 A T 19: 13,471,197 T76S possibly damaging Het
P2rx1 T C 11: 73,009,973 C190R probably damaging Het
Pdzrn4 T A 15: 92,399,749 D198E probably benign Het
Ptar1 A G 19: 23,687,460 M1V probably null Het
Ptch1 T G 13: 63,524,959 E944A probably benign Het
Purg T A 8: 33,386,991 L219* probably null Het
Rbp3 G T 14: 33,955,390 V432L possibly damaging Het
Scnn1b G T 7: 121,914,332 probably null Het
Sgms1 A G 19: 32,142,792 V238A possibly damaging Het
Slc16a14 G T 1: 84,912,507 S359* probably null Het
Smarca2 G A 19: 26,683,927 probably null Het
Spatc1l A G 10: 76,562,489 S42G probably benign Het
Stra6 T A 9: 58,135,190 V34E probably damaging Het
Tex14 A G 11: 87,538,623 probably null Het
Tox4 T C 14: 52,285,904 probably null Het
Tyr A G 7: 87,437,940 S455P probably benign Het
Uggt2 T C 14: 119,026,433 N1062D possibly damaging Het
Umod A C 7: 119,476,690 N284K possibly damaging Het
Unc93b1 T C 19: 3,943,572 I338T probably damaging Het
Vmn2r99 C T 17: 19,378,570 T172I possibly damaging Het
Whrn G A 4: 63,415,639 Q415* probably null Het
Other mutations in Ezh2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01582:Ezh2 APN 6 47556055 nonsense probably null
IGL01932:Ezh2 APN 6 47532048 missense probably damaging 0.99
IGL02019:Ezh2 APN 6 47551901 splice site probably null
IGL02748:Ezh2 APN 6 47558239 missense probably damaging 1.00
IGL02749:Ezh2 APN 6 47533764 missense probably damaging 0.99
IGL03171:Ezh2 APN 6 47540781 nonsense probably null
R0417:Ezh2 UTSW 6 47551726 missense probably benign 0.00
R1256:Ezh2 UTSW 6 47541855 nonsense probably null
R1587:Ezh2 UTSW 6 47552490 critical splice acceptor site probably null
R1631:Ezh2 UTSW 6 47577658 start codon destroyed probably null 0.01
R1736:Ezh2 UTSW 6 47576660 missense probably damaging 1.00
R1775:Ezh2 UTSW 6 47576660 missense probably damaging 1.00
R2076:Ezh2 UTSW 6 47576633 nonsense probably null
R2311:Ezh2 UTSW 6 47558260 missense probably damaging 1.00
R3751:Ezh2 UTSW 6 47556064 missense possibly damaging 0.94
R4119:Ezh2 UTSW 6 47544548 missense probably benign 0.00
R4214:Ezh2 UTSW 6 47533814 missense probably damaging 1.00
R4770:Ezh2 UTSW 6 47540696 missense probably damaging 1.00
R5133:Ezh2 UTSW 6 47540750 missense probably damaging 1.00
R5137:Ezh2 UTSW 6 47532080 splice site probably null
R5199:Ezh2 UTSW 6 47551725 missense probably benign 0.01
R5343:Ezh2 UTSW 6 47576615 missense probably damaging 1.00
R5584:Ezh2 UTSW 6 47532016 missense probably damaging 1.00
R5942:Ezh2 UTSW 6 47577582 missense possibly damaging 0.94
R6057:Ezh2 UTSW 6 47552423 missense probably damaging 1.00
R7247:Ezh2 UTSW 6 47533774 missense probably damaging 1.00
R7284:Ezh2 UTSW 6 47544519 missense probably benign 0.00
R7365:Ezh2 UTSW 6 47533758 nonsense probably null
R7382:Ezh2 UTSW 6 47551836 missense possibly damaging 0.55
R7718:Ezh2 UTSW 6 47554191 missense probably benign
R7910:Ezh2 UTSW 6 47556143 missense probably damaging 0.96
R7991:Ezh2 UTSW 6 47556143 missense probably damaging 0.96
X0021:Ezh2 UTSW 6 47554169 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- GGATAATGAGCACATGTTATTCCTG -3'
(R):5'- TCAGTCGTCTTTGCATATGTGTCAG -3'

Sequencing Primer
(F):5'- GCACATGTTATTCCTGTGTTTAAACC -3'
(R):5'- AACATCCTGAGTATGGGTCCTTAC -3'
Posted On2015-04-29