Incidental Mutation 'R4016:Mrgpra6'
ID311937
Institutional Source Beutler Lab
Gene Symbol Mrgpra6
Ensembl Gene ENSMUSG00000052303
Gene NameMAS-related GPR, member A6
SynonymsMrgA6
MMRRC Submission 040847-MU
Accession Numbers

Genbank: NM_205821; MGI: 3033107

Is this an essential gene? Probably non essential (E-score: 0.051) question?
Stock #R4016 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location47185707-47204920 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 47188715 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Phenylalanine at position 245 (C245F)
Ref Sequence ENSEMBL: ENSMUSP00000140353 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000073793] [ENSMUST00000186456]
Predicted Effect probably benign
Transcript: ENSMUST00000073793
AA Change: C214F

PolyPhen 2 Score 0.438 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000073463
Gene: ENSMUSG00000052303
AA Change: C214F

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srx 17 198 5.9e-8 PFAM
Pfam:7tm_1 26 258 5.2e-14 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000186456
AA Change: C245F

PolyPhen 2 Score 0.763 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000140353
Gene: ENSMUSG00000052303
AA Change: C245F

DomainStartEndE-ValueType
low complexity region 13 26 N/A INTRINSIC
Pfam:7TM_GPCR_Srx 48 228 1.1e-5 PFAM
Pfam:7tm_1 57 270 1e-15 PFAM
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 93.4%
Validation Efficiency 100% (49/49)
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aldh8a1 G A 10: 21,395,571 V399I probably benign Het
Apold1 A G 6: 134,983,906 I108V probably benign Het
Arpc5 G A 1: 152,768,856 probably benign Het
Capn11 T A 17: 45,653,756 D45V probably damaging Het
Dctpp1 G A 7: 127,257,113 R146C probably damaging Het
Dlat C T 9: 50,649,631 probably null Het
Dock10 T A 1: 80,606,569 D140V probably damaging Het
Dtx3 A G 10: 127,191,171 V378A probably benign Het
Ezh2 A G 6: 47,544,582 I414T probably benign Het
Gm1979 C T 5: 26,004,606 W41* probably null Het
Igf2bp2 T C 16: 22,063,676 N425S probably damaging Het
Kdm5a T A 6: 120,394,106 Y504N probably damaging Het
Map3k21 T A 8: 125,911,185 I170N probably damaging Het
Nipal2 T G 15: 34,600,061 K203N possibly damaging Het
Nlrp1b A G 11: 71,173,085 F621S probably damaging Het
Nos3 G A 5: 24,371,716 V448M probably damaging Het
Ntrk3 G T 7: 78,462,947 probably benign Het
Olfr1474 A T 19: 13,471,197 T76S possibly damaging Het
P2rx1 T C 11: 73,009,973 C190R probably damaging Het
Pdzrn4 T A 15: 92,399,749 D198E probably benign Het
Ptar1 A G 19: 23,687,460 M1V probably null Het
Ptch1 T G 13: 63,524,959 E944A probably benign Het
Purg T A 8: 33,386,991 L219* probably null Het
Rbp3 G T 14: 33,955,390 V432L possibly damaging Het
Scnn1b G T 7: 121,914,332 probably null Het
Sgms1 A G 19: 32,142,792 V238A possibly damaging Het
Slc16a14 G T 1: 84,912,507 S359* probably null Het
Smarca2 G A 19: 26,683,927 probably null Het
Spatc1l A G 10: 76,562,489 S42G probably benign Het
Stra6 T A 9: 58,135,190 V34E probably damaging Het
Tex14 A G 11: 87,538,623 probably null Het
Tox4 T C 14: 52,285,904 probably null Het
Tyr A G 7: 87,437,940 S455P probably benign Het
Uggt2 T C 14: 119,026,433 N1062D possibly damaging Het
Umod A C 7: 119,476,690 N284K possibly damaging Het
Unc93b1 T C 19: 3,943,572 I338T probably damaging Het
Vmn2r99 C T 17: 19,378,570 T172I possibly damaging Het
Whrn G A 4: 63,415,639 Q415* probably null Het
Other mutations in Mrgpra6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01645:Mrgpra6 APN 7 47185933 missense probably benign 0.00
IGL01780:Mrgpra6 APN 7 47188749 missense probably damaging 1.00
IGL01801:Mrgpra6 APN 7 47185824 missense possibly damaging 0.90
IGL02158:Mrgpra6 APN 7 47185952 nonsense probably null
IGL02715:Mrgpra6 APN 7 47188648 splice site probably benign
IGL02896:Mrgpra6 APN 7 47188907 missense probably benign 0.02
D4216:Mrgpra6 UTSW 7 47188756 missense probably damaging 0.96
R1566:Mrgpra6 UTSW 7 47188904 missense probably benign 0.02
R5051:Mrgpra6 UTSW 7 47185942 missense probably benign 0.00
R5384:Mrgpra6 UTSW 7 47188881 missense probably damaging 1.00
R5386:Mrgpra6 UTSW 7 47188881 missense probably damaging 1.00
R5638:Mrgpra6 UTSW 7 47185909 missense probably damaging 1.00
R5860:Mrgpra6 UTSW 7 47189351 missense probably benign 0.41
R6633:Mrgpra6 UTSW 7 47188745 missense possibly damaging 0.89
R6952:Mrgpra6 UTSW 7 47185945 missense probably benign 0.01
R6980:Mrgpra6 UTSW 7 47188949 missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- GAATTGCTCTGGCTAATACTTCAAG -3'
(R):5'- ATGGGTGTCTAGCAATGAACTTC -3'

Sequencing Primer
(F):5'- AAAGTGGGCAGCCTTGTC -3'
(R):5'- GGGTGTCTAGCAATGAACTTCCTTAC -3'
Posted On2015-04-29