Incidental Mutation 'R4016:Scnn1b'
ID311942
Institutional Source Beutler Lab
Gene Symbol Scnn1b
Ensembl Gene ENSMUSG00000030873
Gene Namesodium channel, nonvoltage-gated 1 beta
SynonymsENaC beta
MMRRC Submission 040847-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4016 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location121865038-121918514 bp(+) (GRCm38)
Type of Mutationsplice site (3 bp from exon)
DNA Base Change (assembly) G to T at 121914332 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000033161 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000033161] [ENSMUST00000205438] [ENSMUST00000205520] [ENSMUST00000206079]
Predicted Effect probably null
Transcript: ENSMUST00000033161
SMART Domains Protein: ENSMUSP00000033161
Gene: ENSMUSG00000030873

DomainStartEndE-ValueType
Pfam:ASC 29 541 2.4e-93 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000205438
Predicted Effect probably benign
Transcript: ENSMUST00000205520
Predicted Effect probably benign
Transcript: ENSMUST00000206079
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 93.4%
Validation Efficiency 100% (49/49)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Nonvoltage-gated, amiloride-sensitive, sodium channels control fluid and electrolyte transport across epithelia in many organs. These channels are heteromeric complexes consisting of 3 subunits: alpha, beta, and gamma. This gene encodes the beta subunit, and mutations in this gene have been associated with pseudohypoaldosteronism type 1 (PHA1), and Liddle syndrome. [provided by RefSeq, Apr 2009]
PHENOTYPE: Homozygous mutation of this gene results in death shortly after birth, decreased serum sodium levels but higher urine sodium levels and increased serum potassium and chloride levels but lower potassium urine levels. Another homozygous mutation exhibits no abnormal phenotype. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aldh8a1 G A 10: 21,395,571 V399I probably benign Het
Apold1 A G 6: 134,983,906 I108V probably benign Het
Arpc5 G A 1: 152,768,856 probably benign Het
Capn11 T A 17: 45,653,756 D45V probably damaging Het
Dctpp1 G A 7: 127,257,113 R146C probably damaging Het
Dlat C T 9: 50,649,631 probably null Het
Dock10 T A 1: 80,606,569 D140V probably damaging Het
Dtx3 A G 10: 127,191,171 V378A probably benign Het
Ezh2 A G 6: 47,544,582 I414T probably benign Het
Gm1979 C T 5: 26,004,606 W41* probably null Het
Igf2bp2 T C 16: 22,063,676 N425S probably damaging Het
Kdm5a T A 6: 120,394,106 Y504N probably damaging Het
Map3k21 T A 8: 125,911,185 I170N probably damaging Het
Mrgpra6 C A 7: 47,188,715 C245F possibly damaging Het
Nipal2 T G 15: 34,600,061 K203N possibly damaging Het
Nlrp1b A G 11: 71,173,085 F621S probably damaging Het
Nos3 G A 5: 24,371,716 V448M probably damaging Het
Ntrk3 G T 7: 78,462,947 probably benign Het
Olfr1474 A T 19: 13,471,197 T76S possibly damaging Het
P2rx1 T C 11: 73,009,973 C190R probably damaging Het
Pdzrn4 T A 15: 92,399,749 D198E probably benign Het
Ptar1 A G 19: 23,687,460 M1V probably null Het
Ptch1 T G 13: 63,524,959 E944A probably benign Het
Purg T A 8: 33,386,991 L219* probably null Het
Rbp3 G T 14: 33,955,390 V432L possibly damaging Het
Sgms1 A G 19: 32,142,792 V238A possibly damaging Het
Slc16a14 G T 1: 84,912,507 S359* probably null Het
Smarca2 G A 19: 26,683,927 probably null Het
Spatc1l A G 10: 76,562,489 S42G probably benign Het
Stra6 T A 9: 58,135,190 V34E probably damaging Het
Tex14 A G 11: 87,538,623 probably null Het
Tox4 T C 14: 52,285,904 probably null Het
Tyr A G 7: 87,437,940 S455P probably benign Het
Uggt2 T C 14: 119,026,433 N1062D possibly damaging Het
Umod A C 7: 119,476,690 N284K possibly damaging Het
Unc93b1 T C 19: 3,943,572 I338T probably damaging Het
Vmn2r99 C T 17: 19,378,570 T172I possibly damaging Het
Whrn G A 4: 63,415,639 Q415* probably null Het
Other mutations in Scnn1b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01021:Scnn1b APN 7 121918036 missense probably damaging 1.00
IGL01108:Scnn1b APN 7 121914332 splice site probably null
IGL02191:Scnn1b APN 7 121917513 missense probably damaging 1.00
IGL02197:Scnn1b APN 7 121902890 missense probably null 0.89
IGL02355:Scnn1b APN 7 121917547 missense probably damaging 1.00
IGL02362:Scnn1b APN 7 121917547 missense probably damaging 1.00
IGL02554:Scnn1b APN 7 121917523 missense probably damaging 1.00
IGL02834:Scnn1b APN 7 121912062 missense probably damaging 1.00
R0266:Scnn1b UTSW 7 121912475 missense probably damaging 1.00
R0494:Scnn1b UTSW 7 121899458 missense probably damaging 1.00
R0849:Scnn1b UTSW 7 121912475 missense probably damaging 1.00
R0872:Scnn1b UTSW 7 121914330 critical splice donor site probably null
R0899:Scnn1b UTSW 7 121917715 missense probably damaging 1.00
R1386:Scnn1b UTSW 7 121902488 missense possibly damaging 0.60
R1406:Scnn1b UTSW 7 121902544 critical splice donor site probably null
R1406:Scnn1b UTSW 7 121902544 critical splice donor site probably null
R1662:Scnn1b UTSW 7 121902328 missense probably benign 0.00
R1782:Scnn1b UTSW 7 121917961 missense probably benign
R1829:Scnn1b UTSW 7 121902845 missense probably benign 0.00
R1861:Scnn1b UTSW 7 121914261 missense probably damaging 1.00
R1928:Scnn1b UTSW 7 121910447 missense probably damaging 1.00
R4192:Scnn1b UTSW 7 121902739 missense possibly damaging 0.63
R4504:Scnn1b UTSW 7 121912475 missense probably damaging 1.00
R4745:Scnn1b UTSW 7 121902286 missense probably benign 0.03
R4888:Scnn1b UTSW 7 121902887 missense probably benign 0.06
R4941:Scnn1b UTSW 7 121912008 missense probably damaging 1.00
R5121:Scnn1b UTSW 7 121902887 missense probably benign 0.06
R6379:Scnn1b UTSW 7 121915328 missense probably benign 0.10
R6516:Scnn1b UTSW 7 121912112 missense probably damaging 1.00
R6650:Scnn1b UTSW 7 121902820 missense probably damaging 0.97
R6730:Scnn1b UTSW 7 121902877 missense probably damaging 1.00
R7151:Scnn1b UTSW 7 121917886 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGGCTGTAACTTCTCTGGGC -3'
(R):5'- GTACAGGGATGTACATGGCAC -3'

Sequencing Primer
(F):5'- CTCCTTCCTGTTACTGGAGTGG -3'
(R):5'- CAGCTATGTGTCTCAAGC -3'
Posted On2015-04-29