Incidental Mutation 'R4016:Purg'
ID311944
Institutional Source Beutler Lab
Gene Symbol Purg
Ensembl Gene ENSMUSG00000049184
Gene Namepurine-rich element binding protein G
Synonyms4930486B15Rik
MMRRC Submission 040847-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.246) question?
Stock #R4016 (G1)
Quality Score225
Status Validated
Chromosome8
Chromosomal Location33386325-33417467 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) T to A at 33386991 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Stop codon at position 219 (L219*)
Ref Sequence ENSEMBL: ENSMUSP00000077205 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000033990] [ENSMUST00000033991] [ENSMUST00000070340] [ENSMUST00000078058]
Predicted Effect probably benign
Transcript: ENSMUST00000033990
SMART Domains Protein: ENSMUSP00000033990
Gene: ENSMUSG00000031583

DomainStartEndE-ValueType
35EXOc 47 226 1e-47 SMART
low complexity region 484 489 N/A INTRINSIC
DEXDc 509 704 2.3e-28 SMART
HELICc 743 824 3.7e-27 SMART
RQC 923 1028 3.1e-28 SMART
HRDC 1115 1194 1.5e-26 SMART
low complexity region 1205 1216 N/A INTRINSIC
Pfam:HTH_40 1222 1318 2.7e-9 PFAM
low complexity region 1342 1356 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000033991
SMART Domains Protein: ENSMUSP00000033991
Gene: ENSMUSG00000031583

DomainStartEndE-ValueType
35EXOc 47 226 1.1e-47 SMART
low complexity region 484 489 N/A INTRINSIC
DEXDc 509 704 2.4e-28 SMART
HELICc 743 824 3.7e-27 SMART
Pfam:RecQ_Zn_bind 835 905 2.2e-8 PFAM
RQC 923 1028 3.2e-28 SMART
HRDC 1115 1194 1.5e-26 SMART
low complexity region 1205 1216 N/A INTRINSIC
Pfam:HTH_40 1223 1317 4.3e-10 PFAM
low complexity region 1342 1356 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000070340
AA Change: L219*
SMART Domains Protein: ENSMUSP00000065002
Gene: ENSMUSG00000049184
AA Change: L219*

DomainStartEndE-ValueType
low complexity region 3 27 N/A INTRINSIC
PUR 62 130 3.39e-16 SMART
PUR 173 247 1.25e-19 SMART
PUR 264 325 1.66e-19 SMART
Predicted Effect probably null
Transcript: ENSMUST00000078058
AA Change: L219*
SMART Domains Protein: ENSMUSP00000077205
Gene: ENSMUSG00000049184
AA Change: L219*

DomainStartEndE-ValueType
low complexity region 3 27 N/A INTRINSIC
PUR 62 130 3.39e-16 SMART
PUR 173 247 1.25e-19 SMART
PUR 264 317 2.1e-2 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000209293
Meta Mutation Damage Score 0.9754 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 93.4%
Validation Efficiency 100% (49/49)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The exact function of this gene is not known, however, its encoded product is highly similar to purine-rich element binding protein A. The latter is a DNA-binding protein which binds preferentially to the single strand of the purine-rich element termed PUR, and has been implicated in the control of both DNA replication and transcription. This gene lies in close proximity to the Werner syndrome gene, but on the opposite strand, on chromosome 8p11. [provided by RefSeq, Apr 2016]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aldh8a1 G A 10: 21,395,571 V399I probably benign Het
Apold1 A G 6: 134,983,906 I108V probably benign Het
Arpc5 G A 1: 152,768,856 probably benign Het
Capn11 T A 17: 45,653,756 D45V probably damaging Het
Dctpp1 G A 7: 127,257,113 R146C probably damaging Het
Dlat C T 9: 50,649,631 probably null Het
Dock10 T A 1: 80,606,569 D140V probably damaging Het
Dtx3 A G 10: 127,191,171 V378A probably benign Het
Ezh2 A G 6: 47,544,582 I414T probably benign Het
Gm1979 C T 5: 26,004,606 W41* probably null Het
Igf2bp2 T C 16: 22,063,676 N425S probably damaging Het
Kdm5a T A 6: 120,394,106 Y504N probably damaging Het
Map3k21 T A 8: 125,911,185 I170N probably damaging Het
Mrgpra6 C A 7: 47,188,715 C245F possibly damaging Het
Nipal2 T G 15: 34,600,061 K203N possibly damaging Het
Nlrp1b A G 11: 71,173,085 F621S probably damaging Het
Nos3 G A 5: 24,371,716 V448M probably damaging Het
Ntrk3 G T 7: 78,462,947 probably benign Het
Olfr1474 A T 19: 13,471,197 T76S possibly damaging Het
P2rx1 T C 11: 73,009,973 C190R probably damaging Het
Pdzrn4 T A 15: 92,399,749 D198E probably benign Het
Ptar1 A G 19: 23,687,460 M1V probably null Het
Ptch1 T G 13: 63,524,959 E944A probably benign Het
Rbp3 G T 14: 33,955,390 V432L possibly damaging Het
Scnn1b G T 7: 121,914,332 probably null Het
Sgms1 A G 19: 32,142,792 V238A possibly damaging Het
Slc16a14 G T 1: 84,912,507 S359* probably null Het
Smarca2 G A 19: 26,683,927 probably null Het
Spatc1l A G 10: 76,562,489 S42G probably benign Het
Stra6 T A 9: 58,135,190 V34E probably damaging Het
Tex14 A G 11: 87,538,623 probably null Het
Tox4 T C 14: 52,285,904 probably null Het
Tyr A G 7: 87,437,940 S455P probably benign Het
Uggt2 T C 14: 119,026,433 N1062D possibly damaging Het
Umod A C 7: 119,476,690 N284K possibly damaging Het
Unc93b1 T C 19: 3,943,572 I338T probably damaging Het
Vmn2r99 C T 17: 19,378,570 T172I possibly damaging Het
Whrn G A 4: 63,415,639 Q415* probably null Het
Other mutations in Purg
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01323:Purg APN 8 33386603 missense probably damaging 0.99
R1116:Purg UTSW 8 33386745 missense probably benign 0.37
R1185:Purg UTSW 8 33386869 nonsense probably null
R1185:Purg UTSW 8 33386869 nonsense probably null
R1185:Purg UTSW 8 33386869 nonsense probably null
R2945:Purg UTSW 8 33386643 missense probably damaging 1.00
R3859:Purg UTSW 8 33386559 missense possibly damaging 0.75
R4296:Purg UTSW 8 33387293 missense probably damaging 1.00
R4854:Purg UTSW 8 33387314 missense possibly damaging 0.93
R5928:Purg UTSW 8 33386952 missense probably benign 0.00
R6337:Purg UTSW 8 33386423 missense possibly damaging 0.53
R7580:Purg UTSW 8 33416633 missense possibly damaging 0.62
Predicted Primers PCR Primer
(F):5'- TCAGTGGGGTCAGAAGAGCATC -3'
(R):5'- GTATTACGGTAAGGCGGTCTC -3'

Sequencing Primer
(F):5'- GTCAGAAGAGCATCCTCACAGTG -3'
(R):5'- TAAGGCGGTCTCACCTCAC -3'
Posted On2015-04-29