Mutagenetix > Incidental Mutation

Incidental Mutation 'R4016:Stra6'

311947

Institutional Source

Beutler Lab

Gene Symbol

Stra6

Ensembl Gene

ENSMUSG00000032327

Gene Name

stimulated by retinoic acid gene 6

Synonyms

MMRRC Submission

040847-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.059) question?

Stock #

R4016 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

57971071-58061279 bp(+) (GRCm39)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 58042473 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Valine to Glutamic Acid at position 34 (V34E)

Ref Sequence

ENSEMBL: ENSMUSP00000118242 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000034880] [ENSMUST00000085677] [ENSMUST00000128021] [ENSMUST00000128378] [ENSMUST00000133287] [ENSMUST00000134450] [ENSMUST00000134955] [ENSMUST00000136154] [ENSMUST00000136338] [ENSMUST00000147134] [ENSMUST00000150820] [ENSMUST00000167479] [ENSMUST00000170397]

AlphaFold

no structure available at present

Predicted Effect

possibly damaging
Transcript: ENSMUST00000034880
AA Change: V34E

PolyPhen 2 Score 0.485 (Sensitivity: 0.88; Specificity: 0.90)

SMART Domains

Protein: ENSMUSP00000034880
Gene: ENSMUSG00000032327
AA Change: V34E

Domain	Start	End	E-Value	Type
Pfam:RBP_receptor	40	659	1.6e-253	PFAM

Predicted Effect

possibly damaging
Transcript: ENSMUST00000085677
AA Change: V34E

PolyPhen 2 Score 0.485 (Sensitivity: 0.88; Specificity: 0.90)

SMART Domains

Protein: ENSMUSP00000082820
Gene: ENSMUSG00000032327
AA Change: V34E

Domain	Start	End	E-Value	Type
Pfam:RBP_receptor	41	658	1.9e-248	PFAM

Predicted Effect

possibly damaging
Transcript: ENSMUST00000128021
AA Change: V34E

PolyPhen 2 Score 0.485 (Sensitivity: 0.88; Specificity: 0.90)

SMART Domains

Protein: ENSMUSP00000117832
Gene: ENSMUSG00000032327
AA Change: V34E

Domain	Start	End	E-Value	Type
Pfam:RBP_receptor	40	87	8.1e-11	PFAM

Predicted Effect

possibly damaging
Transcript: ENSMUST00000128378
AA Change: V34E

PolyPhen 2 Score 0.670 (Sensitivity: 0.86; Specificity: 0.91)

SMART Domains

Protein: ENSMUSP00000115511
Gene: ENSMUSG00000032327
AA Change: V34E

Domain	Start	End	E-Value	Type
Pfam:RBP_receptor	40	164	4.7e-40	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000133287
AA Change: V34E

PolyPhen 2 Score 0.415 (Sensitivity: 0.89; Specificity: 0.90)

SMART Domains

Protein: ENSMUSP00000114346
Gene: ENSMUSG00000032327
AA Change: V34E

Domain	Start	End	E-Value	Type
Pfam:RBP_receptor	40	138	3.4e-28	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000134450
AA Change: V34E

PolyPhen 2 Score 0.990 (Sensitivity: 0.72; Specificity: 0.97)

Predicted Effect

probably benign
Transcript: ENSMUST00000134955
AA Change: V34E

PolyPhen 2 Score 0.185 (Sensitivity: 0.92; Specificity: 0.87)

SMART Domains

Protein: ENSMUSP00000117280
Gene: ENSMUSG00000032327
AA Change: V34E

Domain	Start	End	E-Value	Type
Pfam:RBP_receptor	40	190	1.3e-51	PFAM

Predicted Effect

possibly damaging
Transcript: ENSMUST00000136154
AA Change: V34E

PolyPhen 2 Score 0.485 (Sensitivity: 0.88; Specificity: 0.90)

SMART Domains

Protein: ENSMUSP00000119062
Gene: ENSMUSG00000032327
AA Change: V34E

Domain	Start	End	E-Value	Type
Pfam:RBP_receptor	40	199	1.7e-56	PFAM

Predicted Effect

possibly damaging
Transcript: ENSMUST00000136338
AA Change: V34E

PolyPhen 2 Score 0.861 (Sensitivity: 0.83; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000115314
Gene: ENSMUSG00000032327
AA Change: V34E

Domain	Start	End	E-Value	Type
Pfam:RBP_receptor	40	99	4e-16	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000145886

Predicted Effect

possibly damaging
Transcript: ENSMUST00000147134
AA Change: V34E

PolyPhen 2 Score 0.670 (Sensitivity: 0.86; Specificity: 0.91)

SMART Domains

Protein: ENSMUSP00000115315
Gene: ENSMUSG00000032327
AA Change: V34E

Domain	Start	End	E-Value	Type
Pfam:RBP_receptor	40	162	6.2e-38	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000150820
AA Change: V34E

PolyPhen 2 Score 0.415 (Sensitivity: 0.89; Specificity: 0.90)

SMART Domains

Protein: ENSMUSP00000122373
Gene: ENSMUSG00000032327
AA Change: V34E

Domain	Start	End	E-Value	Type
Pfam:RBP_receptor	40	168	1.9e-41	PFAM

Predicted Effect

possibly damaging
Transcript: ENSMUST00000167479
AA Change: V34E

PolyPhen 2 Score 0.485 (Sensitivity: 0.88; Specificity: 0.90)

SMART Domains

Protein: ENSMUSP00000128417
Gene: ENSMUSG00000032327
AA Change: V34E

Domain	Start	End	E-Value	Type
Pfam:RBP_receptor	40	659	1.6e-253	PFAM

Predicted Effect

possibly damaging
Transcript: ENSMUST00000170397
AA Change: V34E

PolyPhen 2 Score 0.485 (Sensitivity: 0.88; Specificity: 0.90)

SMART Domains

Protein: ENSMUSP00000130232
Gene: ENSMUSG00000032327
AA Change: V34E

Domain	Start	End	E-Value	Type
Pfam:RBP_receptor	40	659	1.6e-253	PFAM

Meta Mutation Damage Score

0.6467

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 96.8%
20x: 93.4%

Validation Efficiency

100% (49/49)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a membrane protein involved in the metabolism of retinol. The encoded protein acts as a receptor for retinol/retinol binding protein complexes. This protein removes the retinol from the complex and transports it across the cell membrane. Defects in this gene are a cause of syndromic microphthalmia type 9 (MCOPS9). Several transcript variants encoding a few different isoforms have been found for this gene. [provided by RefSeq, Dec 2008]
PHENOTYPE: Male mice homozygous for a gene trap allele exhibit growth retardation. Mice homozygous for a knock-out allele exhibit persistent hyperplastic primary vitreous, shorter inner and outer segment and reduced rod and cone function. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 38 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Aldh8a1	G	A	10: 21,271,470 (GRCm39)	V399I	probably benign	Het
Apold1	A	G	6: 134,960,869 (GRCm39)	I108V	probably benign	Het
Arpc5	G	A	1: 152,644,607 (GRCm39)		probably benign	Het
Capn11	T	A	17: 45,964,682 (GRCm39)	D45V	probably damaging	Het
Dctpp1	G	A	7: 126,856,285 (GRCm39)	R146C	probably damaging	Het
Dlat	C	T	9: 50,560,931 (GRCm39)		probably null	Het
Dock10	T	A	1: 80,584,286 (GRCm39)	D140V	probably damaging	Het
Dtx3	A	G	10: 127,027,040 (GRCm39)	V378A	probably benign	Het
Ezh2	A	G	6: 47,521,516 (GRCm39)	I414T	probably benign	Het
Gm1979	C	T	5: 26,209,604 (GRCm39)	W41*	probably null	Het
Igf2bp2	T	C	16: 21,882,426 (GRCm39)	N425S	probably damaging	Het
Kdm5a	T	A	6: 120,371,067 (GRCm39)	Y504N	probably damaging	Het
Map3k21	T	A	8: 126,637,924 (GRCm39)	I170N	probably damaging	Het
Mrgpra6	C	A	7: 46,838,463 (GRCm39)	C245F	possibly damaging	Het
Nipal2	T	G	15: 34,600,207 (GRCm39)	K203N	possibly damaging	Het
Nlrp1b	A	G	11: 71,063,911 (GRCm39)	F621S	probably damaging	Het
Nos3	G	A	5: 24,576,714 (GRCm39)	V448M	probably damaging	Het
Ntrk3	G	T	7: 78,112,695 (GRCm39)		probably benign	Het
Or5b118	A	T	19: 13,448,561 (GRCm39)	T76S	possibly damaging	Het
P2rx1	T	C	11: 72,900,799 (GRCm39)	C190R	probably damaging	Het
Pdzrn4	T	A	15: 92,297,630 (GRCm39)	D198E	probably benign	Het
Ptar1	A	G	19: 23,664,824 (GRCm39)	M1V	probably null	Het
Ptch1	T	G	13: 63,672,773 (GRCm39)	E944A	probably benign	Het
Purg	T	A	8: 33,877,019 (GRCm39)	L219*	probably null	Het
Rbp3	G	T	14: 33,677,347 (GRCm39)	V432L	possibly damaging	Het
Scnn1b	G	T	7: 121,513,555 (GRCm39)		probably null	Het
Sgms1	A	G	19: 32,120,192 (GRCm39)	V238A	possibly damaging	Het
Slc16a14	G	T	1: 84,890,228 (GRCm39)	S359*	probably null	Het
Smarca2	G	A	19: 26,661,327 (GRCm39)		probably null	Het
Spatc1l	A	G	10: 76,398,323 (GRCm39)	S42G	probably benign	Het
Tex14	A	G	11: 87,429,449 (GRCm39)		probably null	Het
Tox4	T	C	14: 52,523,361 (GRCm39)		probably null	Het
Tyr	A	G	7: 87,087,148 (GRCm39)	S455P	probably benign	Het
Uggt2	T	C	14: 119,263,845 (GRCm39)	N1062D	possibly damaging	Het
Umod	A	C	7: 119,075,913 (GRCm39)	N284K	possibly damaging	Het
Unc93b1	T	C	19: 3,993,572 (GRCm39)	I338T	probably damaging	Het
Vmn2r99	C	T	17: 19,598,832 (GRCm39)	T172I	possibly damaging	Het
Whrn	G	A	4: 63,333,876 (GRCm39)	Q415*	probably null	Het

Other mutations in Stra6

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01327:Stra6	APN	9	58,059,854 (GRCm39)	missense	probably benign	0.01
IGL01885:Stra6	APN	9	58,048,431 (GRCm39)	missense	probably damaging	1.00
IGL02219:Stra6	APN	9	58,047,752 (GRCm39)	missense	probably benign	0.18
IGL02550:Stra6	APN	9	58,057,366 (GRCm39)	missense	possibly damaging	0.95
IGL02745:Stra6	APN	9	58,059,321 (GRCm39)	missense	probably damaging	1.00
IGL02999:Stra6	APN	9	58,042,396 (GRCm39)	missense	probably benign	0.19
R0034:Stra6	UTSW	9	58,058,752 (GRCm39)	splice site	probably null
R0070:Stra6	UTSW	9	58,059,898 (GRCm39)	splice site	probably benign
R0070:Stra6	UTSW	9	58,059,898 (GRCm39)	splice site	probably benign
R0281:Stra6	UTSW	9	58,052,772 (GRCm39)	missense	probably benign	0.11
R0387:Stra6	UTSW	9	58,060,466 (GRCm39)	missense	probably benign	0.13
R0879:Stra6	UTSW	9	58,042,487 (GRCm39)	critical splice donor site	probably null
R1075:Stra6	UTSW	9	58,058,687 (GRCm39)	missense	possibly damaging	0.79
R1605:Stra6	UTSW	9	58,059,166 (GRCm39)	missense	probably benign
R1840:Stra6	UTSW	9	58,047,813 (GRCm39)	missense	probably benign	0.00
R1896:Stra6	UTSW	9	58,059,166 (GRCm39)	missense	probably benign
R2149:Stra6	UTSW	9	58,059,822 (GRCm39)	missense	probably benign	0.01
R4127:Stra6	UTSW	9	58,058,501 (GRCm39)	missense	probably damaging	1.00
R4243:Stra6	UTSW	9	58,050,309 (GRCm39)	missense	probably benign	0.06
R4631:Stra6	UTSW	9	58,048,115 (GRCm39)	intron	probably benign
R4671:Stra6	UTSW	9	58,056,517 (GRCm39)	missense	probably benign	0.01
R4688:Stra6	UTSW	9	58,042,359 (GRCm39)	critical splice acceptor site	probably null
R5091:Stra6	UTSW	9	58,048,429 (GRCm39)	missense	probably damaging	1.00
R6179:Stra6	UTSW	9	58,042,452 (GRCm39)	missense	probably damaging	1.00
R6486:Stra6	UTSW	9	58,058,705 (GRCm39)	frame shift	probably null
R6593:Stra6	UTSW	9	58,059,262 (GRCm39)	missense	probably benign	0.00
R7368:Stra6	UTSW	9	58,058,543 (GRCm39)	missense	probably benign	0.03
R7395:Stra6	UTSW	9	58,048,380 (GRCm39)	missense	probably damaging	1.00
R7503:Stra6	UTSW	9	58,058,528 (GRCm39)	missense	possibly damaging	0.70
R7807:Stra6	UTSW	9	58,057,444 (GRCm39)	missense	probably damaging	0.97
R8099:Stra6	UTSW	9	58,059,777 (GRCm39)	missense	probably damaging	1.00
R8377:Stra6	UTSW	9	58,056,488 (GRCm39)	missense	probably damaging	1.00
R8780:Stra6	UTSW	9	58,042,254 (GRCm39)	intron	probably benign
R8817:Stra6	UTSW	9	58,059,265 (GRCm39)	missense	possibly damaging	0.94
R9117:Stra6	UTSW	9	58,059,822 (GRCm39)	missense	probably benign	0.01
R9495:Stra6	UTSW	9	58,059,175 (GRCm39)	missense	probably benign	0.03
R9582:Stra6	UTSW	9	58,054,770 (GRCm39)	missense	probably damaging	0.97

Predicted Primers

PCR Primer
(F):5'- AGACGACTTTTCCCAGAGAGC -3'
(R):5'- GCCTCAAGCCCTTCTTAATAATAG -3'

Sequencing Primer
(F):5'- GACTTTTCCCAGAGAGCTAAAAG -3'
(R):5'- GTTCAAGAACTGTTGTCCCCAGG -3'

Posted On

2015-04-29