Incidental Mutation 'R4016:Stra6'
List |< first << previous [record 31 of 39] next >> last >|
ID311947
Institutional Source Beutler Lab
Gene Symbol Stra6
Ensembl Gene ENSMUSG00000032327
Gene Namestimulated by retinoic acid gene 6
Synonyms
MMRRC Submission 040847-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.072) question?
Stock #R4016 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location58063788-58153996 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 58135190 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glutamic Acid at position 34 (V34E)
Ref Sequence ENSEMBL: ENSMUSP00000118242 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034880] [ENSMUST00000085677] [ENSMUST00000128021] [ENSMUST00000128378] [ENSMUST00000133287] [ENSMUST00000134450] [ENSMUST00000134955] [ENSMUST00000136154] [ENSMUST00000136338] [ENSMUST00000147134] [ENSMUST00000150820] [ENSMUST00000167479] [ENSMUST00000170397]
Predicted Effect possibly damaging
Transcript: ENSMUST00000034880
AA Change: V34E

PolyPhen 2 Score 0.485 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000034880
Gene: ENSMUSG00000032327
AA Change: V34E

DomainStartEndE-ValueType
Pfam:RBP_receptor 40 659 1.6e-253 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000085677
AA Change: V34E

PolyPhen 2 Score 0.485 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000082820
Gene: ENSMUSG00000032327
AA Change: V34E

DomainStartEndE-ValueType
Pfam:RBP_receptor 41 658 1.9e-248 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000128021
AA Change: V34E

PolyPhen 2 Score 0.485 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000117832
Gene: ENSMUSG00000032327
AA Change: V34E

DomainStartEndE-ValueType
Pfam:RBP_receptor 40 87 8.1e-11 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000128378
AA Change: V34E

PolyPhen 2 Score 0.670 (Sensitivity: 0.86; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000115511
Gene: ENSMUSG00000032327
AA Change: V34E

DomainStartEndE-ValueType
Pfam:RBP_receptor 40 164 4.7e-40 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000133287
AA Change: V34E

PolyPhen 2 Score 0.415 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000114346
Gene: ENSMUSG00000032327
AA Change: V34E

DomainStartEndE-ValueType
Pfam:RBP_receptor 40 138 3.4e-28 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000134450
AA Change: V34E

PolyPhen 2 Score 0.990 (Sensitivity: 0.72; Specificity: 0.97)
Predicted Effect probably benign
Transcript: ENSMUST00000134955
AA Change: V34E

PolyPhen 2 Score 0.185 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000117280
Gene: ENSMUSG00000032327
AA Change: V34E

DomainStartEndE-ValueType
Pfam:RBP_receptor 40 190 1.3e-51 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000136154
AA Change: V34E

PolyPhen 2 Score 0.485 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000119062
Gene: ENSMUSG00000032327
AA Change: V34E

DomainStartEndE-ValueType
Pfam:RBP_receptor 40 199 1.7e-56 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000136338
AA Change: V34E

PolyPhen 2 Score 0.861 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000115314
Gene: ENSMUSG00000032327
AA Change: V34E

DomainStartEndE-ValueType
Pfam:RBP_receptor 40 99 4e-16 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145886
Predicted Effect possibly damaging
Transcript: ENSMUST00000147134
AA Change: V34E

PolyPhen 2 Score 0.670 (Sensitivity: 0.86; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000115315
Gene: ENSMUSG00000032327
AA Change: V34E

DomainStartEndE-ValueType
Pfam:RBP_receptor 40 162 6.2e-38 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000150820
AA Change: V34E

PolyPhen 2 Score 0.415 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000122373
Gene: ENSMUSG00000032327
AA Change: V34E

DomainStartEndE-ValueType
Pfam:RBP_receptor 40 168 1.9e-41 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000167479
AA Change: V34E

PolyPhen 2 Score 0.485 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000128417
Gene: ENSMUSG00000032327
AA Change: V34E

DomainStartEndE-ValueType
Pfam:RBP_receptor 40 659 1.6e-253 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000170397
AA Change: V34E

PolyPhen 2 Score 0.485 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000130232
Gene: ENSMUSG00000032327
AA Change: V34E

DomainStartEndE-ValueType
Pfam:RBP_receptor 40 659 1.6e-253 PFAM
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 93.4%
Validation Efficiency 100% (49/49)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a membrane protein involved in the metabolism of retinol. The encoded protein acts as a receptor for retinol/retinol binding protein complexes. This protein removes the retinol from the complex and transports it across the cell membrane. Defects in this gene are a cause of syndromic microphthalmia type 9 (MCOPS9). Several transcript variants encoding a few different isoforms have been found for this gene. [provided by RefSeq, Dec 2008]
PHENOTYPE: Male mice homozygous for a gene trap allele exhibit growth retardation. Mice homozygous for a knock-out allele exhibit persistent hyperplastic primary vitreous, shorter inner and outer segment and reduced rod and cone function. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aldh8a1 G A 10: 21,395,571 V399I probably benign Het
Apold1 A G 6: 134,983,906 I108V probably benign Het
Arpc5 G A 1: 152,768,856 probably benign Het
Capn11 T A 17: 45,653,756 D45V probably damaging Het
Dctpp1 G A 7: 127,257,113 R146C probably damaging Het
Dlat C T 9: 50,649,631 probably null Het
Dock10 T A 1: 80,606,569 D140V probably damaging Het
Dtx3 A G 10: 127,191,171 V378A probably benign Het
Ezh2 A G 6: 47,544,582 I414T probably benign Het
Gm1979 C T 5: 26,004,606 W41* probably null Het
Igf2bp2 T C 16: 22,063,676 N425S probably damaging Het
Kdm5a T A 6: 120,394,106 Y504N probably damaging Het
Map3k21 T A 8: 125,911,185 I170N probably damaging Het
Mrgpra6 C A 7: 47,188,715 C245F possibly damaging Het
Nipal2 T G 15: 34,600,061 K203N possibly damaging Het
Nlrp1b A G 11: 71,173,085 F621S probably damaging Het
Nos3 G A 5: 24,371,716 V448M probably damaging Het
Ntrk3 G T 7: 78,462,947 probably benign Het
Olfr1474 A T 19: 13,471,197 T76S possibly damaging Het
P2rx1 T C 11: 73,009,973 C190R probably damaging Het
Pdzrn4 T A 15: 92,399,749 D198E probably benign Het
Ptar1 A G 19: 23,687,460 M1V probably null Het
Ptch1 T G 13: 63,524,959 E944A probably benign Het
Purg T A 8: 33,386,991 L219* probably null Het
Rbp3 G T 14: 33,955,390 V432L possibly damaging Het
Scnn1b G T 7: 121,914,332 probably null Het
Sgms1 A G 19: 32,142,792 V238A possibly damaging Het
Slc16a14 G T 1: 84,912,507 S359* probably null Het
Smarca2 G A 19: 26,683,927 probably null Het
Spatc1l A G 10: 76,562,489 S42G probably benign Het
Tex14 A G 11: 87,538,623 probably null Het
Tox4 T C 14: 52,285,904 probably null Het
Tyr A G 7: 87,437,940 S455P probably benign Het
Uggt2 T C 14: 119,026,433 N1062D possibly damaging Het
Umod A C 7: 119,476,690 N284K possibly damaging Het
Unc93b1 T C 19: 3,943,572 I338T probably damaging Het
Vmn2r99 C T 17: 19,378,570 T172I possibly damaging Het
Whrn G A 4: 63,415,639 Q415* probably null Het
Other mutations in Stra6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01327:Stra6 APN 9 58152571 missense probably benign 0.01
IGL01885:Stra6 APN 9 58141148 missense probably damaging 1.00
IGL02219:Stra6 APN 9 58140469 missense probably benign 0.18
IGL02550:Stra6 APN 9 58150083 missense possibly damaging 0.95
IGL02745:Stra6 APN 9 58152038 missense probably damaging 1.00
IGL02999:Stra6 APN 9 58135113 missense probably benign 0.19
R0034:Stra6 UTSW 9 58151469 splice site probably null
R0070:Stra6 UTSW 9 58152615 splice site probably benign
R0070:Stra6 UTSW 9 58152615 splice site probably benign
R0281:Stra6 UTSW 9 58145489 missense probably benign 0.11
R0387:Stra6 UTSW 9 58153183 missense probably benign 0.13
R0879:Stra6 UTSW 9 58135204 critical splice donor site probably null
R1075:Stra6 UTSW 9 58151404 missense possibly damaging 0.79
R1605:Stra6 UTSW 9 58151883 missense probably benign
R1840:Stra6 UTSW 9 58140530 missense probably benign 0.00
R1896:Stra6 UTSW 9 58151883 missense probably benign
R2149:Stra6 UTSW 9 58152539 missense probably benign 0.01
R4127:Stra6 UTSW 9 58151218 missense probably damaging 1.00
R4243:Stra6 UTSW 9 58143026 missense probably benign 0.06
R4631:Stra6 UTSW 9 58140832 intron probably benign
R4671:Stra6 UTSW 9 58149234 missense probably benign 0.01
R4688:Stra6 UTSW 9 58135076 critical splice acceptor site probably null
R5091:Stra6 UTSW 9 58141146 missense probably damaging 1.00
R6179:Stra6 UTSW 9 58135169 missense probably damaging 1.00
R6486:Stra6 UTSW 9 58151422 frame shift probably null
R6593:Stra6 UTSW 9 58151979 missense probably benign 0.00
R7368:Stra6 UTSW 9 58151260 missense probably benign 0.03
R7395:Stra6 UTSW 9 58141097 missense probably damaging 1.00
R7503:Stra6 UTSW 9 58151245 missense possibly damaging 0.70
R7807:Stra6 UTSW 9 58150161 missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- AGACGACTTTTCCCAGAGAGC -3'
(R):5'- GCCTCAAGCCCTTCTTAATAATAG -3'

Sequencing Primer
(F):5'- GACTTTTCCCAGAGAGCTAAAAG -3'
(R):5'- GTTCAAGAACTGTTGTCCCCAGG -3'
Posted On2015-04-29