Incidental Mutation 'R4016:Aldh8a1'
List [record 1 of 39] next >> last >|
ID311949
Institutional Source Beutler Lab
Gene Symbol Aldh8a1
Ensembl Gene ENSMUSG00000037542
Gene Namealdehyde dehydrogenase 8 family, member A1
SynonymsRALDH4
MMRRC Submission 040847-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.077) question?
Stock #R4016 (G1)
Quality Score225
Status Validated
Chromosome10
Chromosomal Location21377291-21396585 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 21395571 bp
ZygosityHeterozygous
Amino Acid Change Valine to Isoleucine at position 399 (V399I)
Ref Sequence ENSEMBL: ENSMUSP00000038878 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000042699]
Predicted Effect probably benign
Transcript: ENSMUST00000042699
AA Change: V399I

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000038878
Gene: ENSMUSG00000037542
AA Change: V399I

DomainStartEndE-ValueType
Pfam:Aldedh 19 483 8.6e-170 PFAM
Meta Mutation Damage Score 0.1109 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 93.4%
Validation Efficiency 100% (49/49)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This protein belongs to the aldehyde dehydrogenases family of proteins. It plays a role in a pathway of 9-cis-retinoic acid biosynthesis in vivo. This enzyme converts 9-cis-retinal into the retinoid X receptor ligand 9-cis-retinoic acid, and has approximately 40-fold higher activity with 9-cis-retinal than with all-trans-retinal. Therefore, it is the first known aldehyde dehydrogenase to show a preference for 9-cis-retinal relative to all-trans-retinal. Three transcript variants encoding distinct protein isoforms have been identified for this gene. [provided by RefSeq, Jul 2010]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Apold1 A G 6: 134,983,906 I108V probably benign Het
Arpc5 G A 1: 152,768,856 probably benign Het
Capn11 T A 17: 45,653,756 D45V probably damaging Het
Dctpp1 G A 7: 127,257,113 R146C probably damaging Het
Dlat C T 9: 50,649,631 probably null Het
Dock10 T A 1: 80,606,569 D140V probably damaging Het
Dtx3 A G 10: 127,191,171 V378A probably benign Het
Ezh2 A G 6: 47,544,582 I414T probably benign Het
Gm1979 C T 5: 26,004,606 W41* probably null Het
Igf2bp2 T C 16: 22,063,676 N425S probably damaging Het
Kdm5a T A 6: 120,394,106 Y504N probably damaging Het
Map3k21 T A 8: 125,911,185 I170N probably damaging Het
Mrgpra6 C A 7: 47,188,715 C245F possibly damaging Het
Nipal2 T G 15: 34,600,061 K203N possibly damaging Het
Nlrp1b A G 11: 71,173,085 F621S probably damaging Het
Nos3 G A 5: 24,371,716 V448M probably damaging Het
Ntrk3 G T 7: 78,462,947 probably benign Het
Olfr1474 A T 19: 13,471,197 T76S possibly damaging Het
P2rx1 T C 11: 73,009,973 C190R probably damaging Het
Pdzrn4 T A 15: 92,399,749 D198E probably benign Het
Ptar1 A G 19: 23,687,460 M1V probably null Het
Ptch1 T G 13: 63,524,959 E944A probably benign Het
Purg T A 8: 33,386,991 L219* probably null Het
Rbp3 G T 14: 33,955,390 V432L possibly damaging Het
Scnn1b G T 7: 121,914,332 probably null Het
Sgms1 A G 19: 32,142,792 V238A possibly damaging Het
Slc16a14 G T 1: 84,912,507 S359* probably null Het
Smarca2 G A 19: 26,683,927 probably null Het
Spatc1l A G 10: 76,562,489 S42G probably benign Het
Stra6 T A 9: 58,135,190 V34E probably damaging Het
Tex14 A G 11: 87,538,623 probably null Het
Tox4 T C 14: 52,285,904 probably null Het
Tyr A G 7: 87,437,940 S455P probably benign Het
Uggt2 T C 14: 119,026,433 N1062D possibly damaging Het
Umod A C 7: 119,476,690 N284K possibly damaging Het
Unc93b1 T C 19: 3,943,572 I338T probably damaging Het
Vmn2r99 C T 17: 19,378,570 T172I possibly damaging Het
Whrn G A 4: 63,415,639 Q415* probably null Het
Other mutations in Aldh8a1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00807:Aldh8a1 APN 10 21395430 missense probably damaging 0.98
IGL01095:Aldh8a1 APN 10 21389281 missense probably benign 0.18
IGL01525:Aldh8a1 APN 10 21391573 missense probably damaging 0.98
IGL02206:Aldh8a1 APN 10 21395575 missense probably benign 0.00
IGL02232:Aldh8a1 APN 10 21395646 missense probably damaging 1.00
IGL03213:Aldh8a1 APN 10 21384717 missense probably damaging 0.97
R0105:Aldh8a1 UTSW 10 21395539 missense probably damaging 0.99
R0105:Aldh8a1 UTSW 10 21395539 missense probably damaging 0.99
R0893:Aldh8a1 UTSW 10 21391694 missense probably benign 0.19
R1168:Aldh8a1 UTSW 10 21384631 splice site probably null
R1764:Aldh8a1 UTSW 10 21395493 missense probably benign 0.01
R4464:Aldh8a1 UTSW 10 21388941 intron probably benign
R4915:Aldh8a1 UTSW 10 21395763 missense probably damaging 1.00
R5816:Aldh8a1 UTSW 10 21395430 missense probably damaging 0.98
R6032:Aldh8a1 UTSW 10 21389071 missense probably benign 0.29
R6032:Aldh8a1 UTSW 10 21389071 missense probably benign 0.29
R6581:Aldh8a1 UTSW 10 21380842 missense probably damaging 1.00
R7422:Aldh8a1 UTSW 10 21389097 missense possibly damaging 0.74
R7458:Aldh8a1 UTSW 10 21395593 missense possibly damaging 0.95
R7574:Aldh8a1 UTSW 10 21380830 missense possibly damaging 0.78
R8014:Aldh8a1 UTSW 10 21389302 missense probably benign 0.03
X0011:Aldh8a1 UTSW 10 21389239 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTCTTGAAAGCTCAGACTGAGGG -3'
(R):5'- AGTCATATGAGTCCTTGGCTCC -3'

Sequencing Primer
(F):5'- TGAGGGTGCCCGGATTCTC -3'
(R):5'- GAGCTCTTCATCCCTCCAAAGG -3'
Posted On2015-04-29