Incidental Mutation 'R4016:Dtx3'
ID311951
Institutional Source Beutler Lab
Gene Symbol Dtx3
Ensembl Gene ENSMUSG00000040415
Gene Namedeltex 3, E3 ubiquitin ligase
Synonyms
MMRRC Submission 040847-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.528) question?
Stock #R4016 (G1)
Quality Score225
Status Validated
Chromosome10
Chromosomal Location127190378-127195728 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 127191171 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 378 (V378A)
Ref Sequence ENSEMBL: ENSMUSP00000111937 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000019611] [ENSMUST00000038217] [ENSMUST00000116229] [ENSMUST00000130855] [ENSMUST00000137151] [ENSMUST00000144322] [ENSMUST00000167353] [ENSMUST00000218587] [ENSMUST00000218654] [ENSMUST00000219245] [ENSMUST00000222006]
Predicted Effect probably benign
Transcript: ENSMUST00000019611
SMART Domains Protein: ENSMUSP00000019611
Gene: ENSMUSG00000019467

DomainStartEndE-ValueType
low complexity region 3 14 N/A INTRINSIC
low complexity region 81 103 N/A INTRINSIC
low complexity region 146 171 N/A INTRINSIC
RhoGEF 203 374 2.45e-49 SMART
PH 394 507 6.67e-1 SMART
low complexity region 561 569 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000038217
SMART Domains Protein: ENSMUSP00000044627
Gene: ENSMUSG00000040415

DomainStartEndE-ValueType
low complexity region 64 72 N/A INTRINSIC
coiled coil region 73 104 N/A INTRINSIC
low complexity region 119 154 N/A INTRINSIC
RING 164 202 1.04e-7 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000116229
AA Change: V378A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000111937
Gene: ENSMUSG00000040415
AA Change: V378A

DomainStartEndE-ValueType
low complexity region 64 72 N/A INTRINSIC
coiled coil region 73 104 N/A INTRINSIC
low complexity region 119 154 N/A INTRINSIC
RING 164 202 1.04e-7 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125254
Predicted Effect probably benign
Transcript: ENSMUST00000130855
SMART Domains Protein: ENSMUSP00000114776
Gene: ENSMUSG00000040415

DomainStartEndE-ValueType
low complexity region 67 75 N/A INTRINSIC
coiled coil region 76 107 N/A INTRINSIC
low complexity region 122 157 N/A INTRINSIC
RING 167 205 1.04e-7 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000137151
Predicted Effect probably benign
Transcript: ENSMUST00000144322
SMART Domains Protein: ENSMUSP00000116510
Gene: ENSMUSG00000040415

DomainStartEndE-ValueType
low complexity region 67 75 N/A INTRINSIC
coiled coil region 76 107 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000167353
SMART Domains Protein: ENSMUSP00000126339
Gene: ENSMUSG00000019467

DomainStartEndE-ValueType
low complexity region 72 94 N/A INTRINSIC
low complexity region 137 162 N/A INTRINSIC
RhoGEF 194 365 2.45e-49 SMART
PH 385 498 6.67e-1 SMART
low complexity region 552 560 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000181578
Predicted Effect noncoding transcript
Transcript: ENSMUST00000218478
Predicted Effect probably benign
Transcript: ENSMUST00000218587
Predicted Effect probably benign
Transcript: ENSMUST00000218654
Predicted Effect probably benign
Transcript: ENSMUST00000218864
Predicted Effect noncoding transcript
Transcript: ENSMUST00000219079
Predicted Effect probably benign
Transcript: ENSMUST00000219245
Predicted Effect noncoding transcript
Transcript: ENSMUST00000219649
Predicted Effect probably benign
Transcript: ENSMUST00000222006
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 93.4%
Validation Efficiency 100% (49/49)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] DTX3 functions as an E3 ubiquitin ligase (Takeyama et al., 2003 [PubMed 12670957]).[supplied by OMIM, Nov 2009]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aldh8a1 G A 10: 21,395,571 V399I probably benign Het
Apold1 A G 6: 134,983,906 I108V probably benign Het
Arpc5 G A 1: 152,768,856 probably benign Het
Capn11 T A 17: 45,653,756 D45V probably damaging Het
Dctpp1 G A 7: 127,257,113 R146C probably damaging Het
Dlat C T 9: 50,649,631 probably null Het
Dock10 T A 1: 80,606,569 D140V probably damaging Het
Ezh2 A G 6: 47,544,582 I414T probably benign Het
Gm1979 C T 5: 26,004,606 W41* probably null Het
Igf2bp2 T C 16: 22,063,676 N425S probably damaging Het
Kdm5a T A 6: 120,394,106 Y504N probably damaging Het
Map3k21 T A 8: 125,911,185 I170N probably damaging Het
Mrgpra6 C A 7: 47,188,715 C245F possibly damaging Het
Nipal2 T G 15: 34,600,061 K203N possibly damaging Het
Nlrp1b A G 11: 71,173,085 F621S probably damaging Het
Nos3 G A 5: 24,371,716 V448M probably damaging Het
Ntrk3 G T 7: 78,462,947 probably benign Het
Olfr1474 A T 19: 13,471,197 T76S possibly damaging Het
P2rx1 T C 11: 73,009,973 C190R probably damaging Het
Pdzrn4 T A 15: 92,399,749 D198E probably benign Het
Ptar1 A G 19: 23,687,460 M1V probably null Het
Ptch1 T G 13: 63,524,959 E944A probably benign Het
Purg T A 8: 33,386,991 L219* probably null Het
Rbp3 G T 14: 33,955,390 V432L possibly damaging Het
Scnn1b G T 7: 121,914,332 probably null Het
Sgms1 A G 19: 32,142,792 V238A possibly damaging Het
Slc16a14 G T 1: 84,912,507 S359* probably null Het
Smarca2 G A 19: 26,683,927 probably null Het
Spatc1l A G 10: 76,562,489 S42G probably benign Het
Stra6 T A 9: 58,135,190 V34E probably damaging Het
Tex14 A G 11: 87,538,623 probably null Het
Tox4 T C 14: 52,285,904 probably null Het
Tyr A G 7: 87,437,940 S455P probably benign Het
Uggt2 T C 14: 119,026,433 N1062D possibly damaging Het
Umod A C 7: 119,476,690 N284K possibly damaging Het
Unc93b1 T C 19: 3,943,572 I338T probably damaging Het
Vmn2r99 C T 17: 19,378,570 T172I possibly damaging Het
Whrn G A 4: 63,415,639 Q415* probably null Het
Other mutations in Dtx3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02131:Dtx3 APN 10 127193279 missense probably damaging 0.99
IGL02314:Dtx3 APN 10 127190959 unclassified probably benign
R0257:Dtx3 UTSW 10 127192892 missense probably benign
R1108:Dtx3 UTSW 10 127191289 missense possibly damaging 0.84
R1422:Dtx3 UTSW 10 127191289 missense possibly damaging 0.84
R3693:Dtx3 UTSW 10 127191424 missense probably benign 0.33
R4231:Dtx3 UTSW 10 127193189 missense possibly damaging 0.92
R4232:Dtx3 UTSW 10 127193189 missense possibly damaging 0.92
R4236:Dtx3 UTSW 10 127193189 missense possibly damaging 0.92
R4590:Dtx3 UTSW 10 127192695 missense probably damaging 0.99
R4838:Dtx3 UTSW 10 127191307 unclassified probably null
R5338:Dtx3 UTSW 10 127193050 missense probably benign 0.23
R5510:Dtx3 UTSW 10 127192938 missense probably benign 0.08
R6989:Dtx3 UTSW 10 127192877 missense probably benign 0.01
R7225:Dtx3 UTSW 10 127191489 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TCTTGCACCCTAGTCAGGTAGG -3'
(R):5'- CCCAATGTCATCACTTGGAACG -3'

Sequencing Primer
(F):5'- CACCCTAGTCAGGTAGGTTGGG -3'
(R):5'- TGTCATCACTTGGAACGACATC -3'
Posted On2015-04-29