Mutagenetix > Incidental Mutation

Incidental Mutation 'R4016:Pdzrn4'

311961

Institutional Source

Beutler Lab

Gene Symbol

Pdzrn4

Ensembl Gene

ENSMUSG00000036218

Gene Name

PDZ domain containing RING finger 4

Synonyms

1110017D07Rik, LNX4, SAMCAP3L

MMRRC Submission

040847-MU

Accession Numbers

Essential gene?

Possibly non essential (E-score: 0.280) question?

Stock #

R4016 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

92396881-92771819 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 92399749 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Glutamic Acid at position 198 (D198E)

Ref Sequence

ENSEMBL: ENSMUSP00000133159 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000169942]

AlphaFold

E9PUZ9

Predicted Effect

probably benign
Transcript: ENSMUST00000169942
AA Change: D198E

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000133159
Gene: ENSMUSG00000036218
AA Change: D198E

Domain	Start	End	E-Value	Type
RING	22	56	1.38e-1	SMART
low complexity region	101	124	N/A	INTRINSIC
PDZ	213	295	3.82e-20	SMART
PDZ	393	468	3.01e-18	SMART
low complexity region	479	498	N/A	INTRINSIC
low complexity region	506	517	N/A	INTRINSIC
coiled coil region	633	669	N/A	INTRINSIC
low complexity region	802	816	N/A	INTRINSIC
low complexity region	935	948	N/A	INTRINSIC
low complexity region	971	980	N/A	INTRINSIC

Meta Mutation Damage Score

0.0667

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 96.8%
20x: 93.4%

Validation Efficiency

100% (49/49)

Allele List at MGI

Other mutations in this stock

Total: 38 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Aldh8a1	G	A	10: 21,395,571	V399I	probably benign	Het
Apold1	A	G	6: 134,983,906	I108V	probably benign	Het
Arpc5	G	A	1: 152,768,856		probably benign	Het
Capn11	T	A	17: 45,653,756	D45V	probably damaging	Het
Dctpp1	G	A	7: 127,257,113	R146C	probably damaging	Het
Dlat	C	T	9: 50,649,631		probably null	Het
Dock10	T	A	1: 80,606,569	D140V	probably damaging	Het
Dtx3	A	G	10: 127,191,171	V378A	probably benign	Het
Ezh2	A	G	6: 47,544,582	I414T	probably benign	Het
Gm1979	C	T	5: 26,004,606	W41*	probably null	Het
Igf2bp2	T	C	16: 22,063,676	N425S	probably damaging	Het
Kdm5a	T	A	6: 120,394,106	Y504N	probably damaging	Het
Map3k21	T	A	8: 125,911,185	I170N	probably damaging	Het
Mrgpra6	C	A	7: 47,188,715	C245F	possibly damaging	Het
Nipal2	T	G	15: 34,600,061	K203N	possibly damaging	Het
Nlrp1b	A	G	11: 71,173,085	F621S	probably damaging	Het
Nos3	G	A	5: 24,371,716	V448M	probably damaging	Het
Ntrk3	G	T	7: 78,462,947		probably benign	Het
Olfr1474	A	T	19: 13,471,197	T76S	possibly damaging	Het
P2rx1	T	C	11: 73,009,973	C190R	probably damaging	Het
Ptar1	A	G	19: 23,687,460	M1V	probably null	Het
Ptch1	T	G	13: 63,524,959	E944A	probably benign	Het
Purg	T	A	8: 33,386,991	L219*	probably null	Het
Rbp3	G	T	14: 33,955,390	V432L	possibly damaging	Het
Scnn1b	G	T	7: 121,914,332		probably null	Het
Sgms1	A	G	19: 32,142,792	V238A	possibly damaging	Het
Slc16a14	G	T	1: 84,912,507	S359*	probably null	Het
Smarca2	G	A	19: 26,683,927		probably null	Het
Spatc1l	A	G	10: 76,562,489	S42G	probably benign	Het
Stra6	T	A	9: 58,135,190	V34E	probably damaging	Het
Tex14	A	G	11: 87,538,623		probably null	Het
Tox4	T	C	14: 52,285,904		probably null	Het
Tyr	A	G	7: 87,437,940	S455P	probably benign	Het
Uggt2	T	C	14: 119,026,433	N1062D	possibly damaging	Het
Umod	A	C	7: 119,476,690	N284K	possibly damaging	Het
Unc93b1	T	C	19: 3,943,572	I338T	probably damaging	Het
Vmn2r99	C	T	17: 19,378,570	T172I	possibly damaging	Het
Whrn	G	A	4: 63,415,639	Q415*	probably null	Het

Other mutations in Pdzrn4

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01932:Pdzrn4	APN	15	92746278	missense	probably damaging	1.00
IGL01991:Pdzrn4	APN	15	92401926	splice site	probably null
IGL02103:Pdzrn4	APN	15	92769887	missense	probably damaging	1.00
IGL02243:Pdzrn4	APN	15	92770696	missense	probably benign	0.30
IGL02269:Pdzrn4	APN	15	92769850	missense	probably damaging	1.00
IGL03005:Pdzrn4	APN	15	92770391	missense	probably damaging	1.00
PIT4362001:Pdzrn4	UTSW	15	92769881	missense	possibly damaging	0.46
R0243:Pdzrn4	UTSW	15	92770319	missense	possibly damaging	0.46
R0367:Pdzrn4	UTSW	15	92757657	missense	possibly damaging	0.53
R0972:Pdzrn4	UTSW	15	92757711	missense	probably benign	0.00
R1168:Pdzrn4	UTSW	15	92770271	missense	probably benign	0.16
R1411:Pdzrn4	UTSW	15	92771013	makesense	probably null
R1466:Pdzrn4	UTSW	15	92770537	missense	probably benign	0.00
R1466:Pdzrn4	UTSW	15	92770537	missense	probably benign	0.00
R1489:Pdzrn4	UTSW	15	92677712	missense	probably benign
R1503:Pdzrn4	UTSW	15	92399804	missense	probably damaging	0.99
R1561:Pdzrn4	UTSW	15	92677637	missense	possibly damaging	0.84
R1584:Pdzrn4	UTSW	15	92770537	missense	probably benign	0.00
R1733:Pdzrn4	UTSW	15	92401974	missense	probably benign	0.06
R1965:Pdzrn4	UTSW	15	92746309	splice site	probably null
R2061:Pdzrn4	UTSW	15	92770160	missense	probably damaging	0.99
R3010:Pdzrn4	UTSW	15	92769811	missense	probably benign	0.32
R4032:Pdzrn4	UTSW	15	92769533	missense	probably damaging	1.00
R4110:Pdzrn4	UTSW	15	92770864	missense	probably benign	0.26
R4180:Pdzrn4	UTSW	15	92402017	missense	possibly damaging	0.93
R4539:Pdzrn4	UTSW	15	92770589	missense	probably damaging	1.00
R4617:Pdzrn4	UTSW	15	92769842	missense	probably damaging	1.00
R4734:Pdzrn4	UTSW	15	92770252	nonsense	probably null
R4900:Pdzrn4	UTSW	15	92770757	missense	probably damaging	1.00
R5422:Pdzrn4	UTSW	15	92677621	missense	probably benign	0.01
R5444:Pdzrn4	UTSW	15	92770925	missense	probably damaging	1.00
R5772:Pdzrn4	UTSW	15	92757681	missense	probably damaging	1.00
R5775:Pdzrn4	UTSW	15	92757681	missense	probably damaging	1.00
R5935:Pdzrn4	UTSW	15	92397374	missense	probably benign	0.01
R6192:Pdzrn4	UTSW	15	92757681	missense	probably damaging	1.00
R6210:Pdzrn4	UTSW	15	92757681	missense	probably damaging	1.00
R6258:Pdzrn4	UTSW	15	92757681	missense	probably damaging	1.00
R6259:Pdzrn4	UTSW	15	92757681	missense	probably damaging	1.00
R6391:Pdzrn4	UTSW	15	92680537	missense	probably damaging	0.99
R6613:Pdzrn4	UTSW	15	92677574	missense	probably damaging	0.99
R7046:Pdzrn4	UTSW	15	92770422	nonsense	probably null
R7096:Pdzrn4	UTSW	15	92397503	missense	probably benign	0.00
R7451:Pdzrn4	UTSW	15	92770067	missense	possibly damaging	0.68
R8075:Pdzrn4	UTSW	15	92677724	missense	probably damaging	0.99
R8125:Pdzrn4	UTSW	15	92743595	missense	probably damaging	1.00
R8324:Pdzrn4	UTSW	15	92770937	missense	probably damaging	1.00
R9332:Pdzrn4	UTSW	15	92397335	missense	probably benign
R9555:Pdzrn4	UTSW	15	92399822	missense	probably damaging	1.00
R9558:Pdzrn4	UTSW	15	92401996	missense	possibly damaging	0.46
R9622:Pdzrn4	UTSW	15	92397068	missense	probably benign
R9763:Pdzrn4	UTSW	15	92770495	missense	probably damaging	1.00
R9796:Pdzrn4	UTSW	15	92680472	missense	possibly damaging	0.93
X0018:Pdzrn4	UTSW	15	92397223	missense	probably benign	0.01
X0020:Pdzrn4	UTSW	15	92397223	missense	probably benign	0.01
X0021:Pdzrn4	UTSW	15	92677709	missense	probably damaging	1.00
X0026:Pdzrn4	UTSW	15	92397223	missense	probably benign	0.01
X0027:Pdzrn4	UTSW	15	92397223	missense	probably benign	0.01
X0027:Pdzrn4	UTSW	15	92680512	missense	possibly damaging	0.92
X0065:Pdzrn4	UTSW	15	92397223	missense	probably benign	0.01
Z1176:Pdzrn4	UTSW	15	92396957	missense	probably benign	0.03

Predicted Primers

PCR Primer
(F):5'- TACTCCCTGTGTGAAGTGCAAATC -3'
(R):5'- TGGGCCCAAACATCCTTTTAAG -3'

Sequencing Primer
(F):5'- CCTGTGTGAAGTGCAAATCCATGTAG -3'
(R):5'- AGGATCATACCCCTTGTTTGTCTGAG -3'

Posted On

2015-04-29