Incidental Mutation 'R4016:Igf2bp2'
ID311962
Institutional Source Beutler Lab
Gene Symbol Igf2bp2
Ensembl Gene ENSMUSG00000033581
Gene Nameinsulin-like growth factor 2 mRNA binding protein 2
SynonymsIMP-2, C330012H03Rik
MMRRC Submission 040847-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.254) question?
Stock #R4016 (G1)
Quality Score225
Status Validated
Chromosome16
Chromosomal Location22059009-22163299 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 22063676 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 425 (N425S)
Ref Sequence ENSEMBL: ENSMUSP00000111037 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000100052] [ENSMUST00000115379]
Predicted Effect probably damaging
Transcript: ENSMUST00000100052
AA Change: N493S

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000097629
Gene: ENSMUSG00000033581
AA Change: N493S

DomainStartEndE-ValueType
RRM 4 72 8.2e-11 SMART
RRM 83 153 4.07e-6 SMART
KH 185 256 1.28e-14 SMART
KH 266 339 1.97e-15 SMART
low complexity region 375 391 N/A INTRINSIC
low complexity region 404 415 N/A INTRINSIC
KH 419 490 1.1e-13 SMART
KH 501 573 2.48e-12 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000115379
AA Change: N425S

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000111037
Gene: ENSMUSG00000033581
AA Change: N425S

DomainStartEndE-ValueType
RRM 15 85 4.07e-6 SMART
KH 117 188 1.28e-14 SMART
KH 198 271 1.97e-15 SMART
low complexity region 307 323 N/A INTRINSIC
low complexity region 336 347 N/A INTRINSIC
KH 351 422 1.1e-13 SMART
KH 433 505 2.48e-12 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124318
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129913
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134188
Predicted Effect noncoding transcript
Transcript: ENSMUST00000231926
Meta Mutation Damage Score 0.0614 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 93.4%
Validation Efficiency 100% (49/49)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that binds the 5' UTR of insulin-like growth factor 2 (IGF2) mRNA and regulates its translation. It plays an important role in metabolism and variation in this gene is associated with susceptibility to diabetes. Alternative splicing and promoter usage results in multiple transcript variants. Related pseudogenes are found on several chromosomes. [provided by RefSeq, Sep 2016]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aldh8a1 G A 10: 21,395,571 V399I probably benign Het
Apold1 A G 6: 134,983,906 I108V probably benign Het
Arpc5 G A 1: 152,768,856 probably benign Het
Capn11 T A 17: 45,653,756 D45V probably damaging Het
Dctpp1 G A 7: 127,257,113 R146C probably damaging Het
Dlat C T 9: 50,649,631 probably null Het
Dock10 T A 1: 80,606,569 D140V probably damaging Het
Dtx3 A G 10: 127,191,171 V378A probably benign Het
Ezh2 A G 6: 47,544,582 I414T probably benign Het
Gm1979 C T 5: 26,004,606 W41* probably null Het
Kdm5a T A 6: 120,394,106 Y504N probably damaging Het
Map3k21 T A 8: 125,911,185 I170N probably damaging Het
Mrgpra6 C A 7: 47,188,715 C245F possibly damaging Het
Nipal2 T G 15: 34,600,061 K203N possibly damaging Het
Nlrp1b A G 11: 71,173,085 F621S probably damaging Het
Nos3 G A 5: 24,371,716 V448M probably damaging Het
Ntrk3 G T 7: 78,462,947 probably benign Het
Olfr1474 A T 19: 13,471,197 T76S possibly damaging Het
P2rx1 T C 11: 73,009,973 C190R probably damaging Het
Pdzrn4 T A 15: 92,399,749 D198E probably benign Het
Ptar1 A G 19: 23,687,460 M1V probably null Het
Ptch1 T G 13: 63,524,959 E944A probably benign Het
Purg T A 8: 33,386,991 L219* probably null Het
Rbp3 G T 14: 33,955,390 V432L possibly damaging Het
Scnn1b G T 7: 121,914,332 probably null Het
Sgms1 A G 19: 32,142,792 V238A possibly damaging Het
Slc16a14 G T 1: 84,912,507 S359* probably null Het
Smarca2 G A 19: 26,683,927 probably null Het
Spatc1l A G 10: 76,562,489 S42G probably benign Het
Stra6 T A 9: 58,135,190 V34E probably damaging Het
Tex14 A G 11: 87,538,623 probably null Het
Tox4 T C 14: 52,285,904 probably null Het
Tyr A G 7: 87,437,940 S455P probably benign Het
Uggt2 T C 14: 119,026,433 N1062D possibly damaging Het
Umod A C 7: 119,476,690 N284K possibly damaging Het
Unc93b1 T C 19: 3,943,572 I338T probably damaging Het
Vmn2r99 C T 17: 19,378,570 T172I possibly damaging Het
Whrn G A 4: 63,415,639 Q415* probably null Het
Other mutations in Igf2bp2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01074:Igf2bp2 APN 16 22063704 missense probably damaging 1.00
IGL02374:Igf2bp2 APN 16 22081868 missense probably benign 0.00
IGL02752:Igf2bp2 APN 16 22080110 missense probably benign 0.00
IGL02884:Igf2bp2 APN 16 22162885 missense probably benign 0.00
IGL03072:Igf2bp2 APN 16 22068141 critical splice donor site probably null
defender UTSW 16 22070306 critical splice donor site probably null
Petite UTSW 16 22079608 critical splice acceptor site probably null
R0008:Igf2bp2 UTSW 16 22076091 missense probably benign 0.22
R0183:Igf2bp2 UTSW 16 22078730 nonsense probably null
R0390:Igf2bp2 UTSW 16 22081801 missense possibly damaging 0.87
R0505:Igf2bp2 UTSW 16 22089099 missense possibly damaging 0.90
R0610:Igf2bp2 UTSW 16 22070309 missense probably benign 0.00
R0696:Igf2bp2 UTSW 16 22080125 missense probably benign 0.19
R0966:Igf2bp2 UTSW 16 22089090 missense probably damaging 1.00
R1101:Igf2bp2 UTSW 16 22162950 missense probably damaging 1.00
R1159:Igf2bp2 UTSW 16 22061853 splice site probably benign
R1169:Igf2bp2 UTSW 16 22078730 nonsense probably null
R1762:Igf2bp2 UTSW 16 22083947 nonsense probably null
R2168:Igf2bp2 UTSW 16 22079608 critical splice acceptor site probably null
R4014:Igf2bp2 UTSW 16 22063676 missense probably damaging 0.99
R4015:Igf2bp2 UTSW 16 22063676 missense probably damaging 0.99
R4017:Igf2bp2 UTSW 16 22063676 missense probably damaging 0.99
R4128:Igf2bp2 UTSW 16 22078621 missense probably benign 0.00
R4986:Igf2bp2 UTSW 16 22070306 critical splice donor site probably null
R5007:Igf2bp2 UTSW 16 22079496 missense probably damaging 1.00
R5268:Igf2bp2 UTSW 16 22079491 missense probably damaging 1.00
R5531:Igf2bp2 UTSW 16 22089085 missense probably damaging 1.00
R6154:Igf2bp2 UTSW 16 22076093 nonsense probably null
R6819:Igf2bp2 UTSW 16 22060836 missense probably damaging 1.00
R6975:Igf2bp2 UTSW 16 22061861 missense probably null 1.00
R7008:Igf2bp2 UTSW 16 22081832 missense probably benign 0.16
R7311:Igf2bp2 UTSW 16 22061882 missense possibly damaging 0.76
X0066:Igf2bp2 UTSW 16 22161291 missense probably benign 0.15
Predicted Primers PCR Primer
(F):5'- CTTCACTGTGAGCATGGGTCAG -3'
(R):5'- TTGCAGAGTGAGGCAATGTATG -3'

Sequencing Primer
(F):5'- AAGGCCCTCCCTCACATGTG -3'
(R):5'- AATGTATGGCGCCCCTGG -3'
Posted On2015-04-29