Incidental Mutation 'R4016:Olfr1474'
ID 311966
Institutional Source Beutler Lab
Gene Symbol Olfr1474
Ensembl Gene ENSMUSG00000096273
Gene Name olfactory receptor 1474
Synonyms MOR202-42, MOR202-26P, GA_x6K02T2RE5P-3803583-3804527
MMRRC Submission 040847-MU
Accession Numbers

Genbank: NM_001011842.1
Essential gene? Probably non essential (E-score: 0.074) question?
Stock # R4016 (G1)
Quality Score 225
Status Validated
Chromosome 19
Chromosomal Location 13469565-13472157 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 13471197 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Threonine to Serine at position 76 (T76S)
Ref Sequence ENSEMBL: ENSMUSP00000151810 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000096202] [ENSMUST00000207529] [ENSMUST00000220113]
AlphaFold Q7TQQ8
Predicted Effect possibly damaging
Transcript: ENSMUST00000096202
AA Change: T76S

PolyPhen 2 Score 0.946 (Sensitivity: 0.80; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000093916
Gene: ENSMUSG00000096273
AA Change: T76S

DomainStartEndE-ValueType
Pfam:7tm_4 29 306 1.6e-52 PFAM
Pfam:7TM_GPCR_Srsx 33 303 1e-7 PFAM
Pfam:7tm_1 39 288 8.7e-22 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000207529
AA Change: T34S

PolyPhen 2 Score 0.863 (Sensitivity: 0.83; Specificity: 0.93)
Predicted Effect possibly damaging
Transcript: ENSMUST00000220113
AA Change: T76S

PolyPhen 2 Score 0.946 (Sensitivity: 0.80; Specificity: 0.95)
Meta Mutation Damage Score 0.2776 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 93.4%
Validation Efficiency 100% (49/49)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI

none
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aldh8a1 G A 10: 21,395,571 V399I probably benign Het
Apold1 A G 6: 134,983,906 I108V probably benign Het
Arpc5 G A 1: 152,768,856 probably benign Het
Capn11 T A 17: 45,653,756 D45V probably damaging Het
Dctpp1 G A 7: 127,257,113 R146C probably damaging Het
Dlat C T 9: 50,649,631 probably null Het
Dock10 T A 1: 80,606,569 D140V probably damaging Het
Dtx3 A G 10: 127,191,171 V378A probably benign Het
Ezh2 A G 6: 47,544,582 I414T probably benign Het
Gm1979 C T 5: 26,004,606 W41* probably null Het
Igf2bp2 T C 16: 22,063,676 N425S probably damaging Het
Kdm5a T A 6: 120,394,106 Y504N probably damaging Het
Map3k21 T A 8: 125,911,185 I170N probably damaging Het
Mrgpra6 C A 7: 47,188,715 C245F possibly damaging Het
Nipal2 T G 15: 34,600,061 K203N possibly damaging Het
Nlrp1b A G 11: 71,173,085 F621S probably damaging Het
Nos3 G A 5: 24,371,716 V448M probably damaging Het
Ntrk3 G T 7: 78,462,947 probably benign Het
P2rx1 T C 11: 73,009,973 C190R probably damaging Het
Pdzrn4 T A 15: 92,399,749 D198E probably benign Het
Ptar1 A G 19: 23,687,460 M1V probably null Het
Ptch1 T G 13: 63,524,959 E944A probably benign Het
Purg T A 8: 33,386,991 L219* probably null Het
Rbp3 G T 14: 33,955,390 V432L possibly damaging Het
Scnn1b G T 7: 121,914,332 probably null Het
Sgms1 A G 19: 32,142,792 V238A possibly damaging Het
Slc16a14 G T 1: 84,912,507 S359* probably null Het
Smarca2 G A 19: 26,683,927 probably null Het
Spatc1l A G 10: 76,562,489 S42G probably benign Het
Stra6 T A 9: 58,135,190 V34E probably damaging Het
Tex14 A G 11: 87,538,623 probably null Het
Tox4 T C 14: 52,285,904 probably null Het
Tyr A G 7: 87,437,940 S455P probably benign Het
Uggt2 T C 14: 119,026,433 N1062D possibly damaging Het
Umod A C 7: 119,476,690 N284K possibly damaging Het
Unc93b1 T C 19: 3,943,572 I338T probably damaging Het
Vmn2r99 C T 17: 19,378,570 T172I possibly damaging Het
Whrn G A 4: 63,415,639 Q415* probably null Het
Other mutations in Olfr1474
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03256:Olfr1474 APN 19 13471267 missense probably damaging 0.99
D605:Olfr1474 UTSW 19 13471157 nonsense probably null
R0173:Olfr1474 UTSW 19 13471701 missense probably benign 0.02
R1102:Olfr1474 UTSW 19 13471407 missense probably damaging 0.97
R1515:Olfr1474 UTSW 19 13471680 missense probably damaging 0.97
R1780:Olfr1474 UTSW 19 13471362 missense probably benign 0.14
R2061:Olfr1474 UTSW 19 13471241 missense probably damaging 0.98
R4485:Olfr1474 UTSW 19 13471555 missense probably benign 0.08
R5119:Olfr1474 UTSW 19 13471546 missense probably benign 0.00
R5150:Olfr1474 UTSW 19 13471430 missense probably benign 0.01
R5156:Olfr1474 UTSW 19 13471673 missense probably damaging 1.00
R5699:Olfr1474 UTSW 19 13470972 start codon destroyed probably null 0.78
R5800:Olfr1474 UTSW 19 13471896 missense probably benign 0.06
R5840:Olfr1474 UTSW 19 13471878 missense probably benign 0.01
R5953:Olfr1474 UTSW 19 13471368 missense possibly damaging 0.92
R5997:Olfr1474 UTSW 19 13471506 missense probably benign 0.12
R6233:Olfr1474 UTSW 19 13471740 missense probably damaging 1.00
R6488:Olfr1474 UTSW 19 13471617 missense probably damaging 1.00
R6847:Olfr1474 UTSW 19 13471038 missense probably benign 0.03
R6964:Olfr1474 UTSW 19 13471361 nonsense probably null
R7214:Olfr1474 UTSW 19 13470973 start codon destroyed probably null 1.00
R8001:Olfr1474 UTSW 19 13471422 missense probably benign 0.03
R8035:Olfr1474 UTSW 19 13471899 missense probably benign
R8129:Olfr1474 UTSW 19 13471144 missense probably damaging 1.00
R9018:Olfr1474 UTSW 19 13471357 missense possibly damaging 0.60
R9061:Olfr1474 UTSW 19 13471159 missense probably damaging 0.98
R9065:Olfr1474 UTSW 19 13471306 missense probably damaging 0.97
R9373:Olfr1474 UTSW 19 13471852 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGTAGGCTTGACAGATGCCC -3'
(R):5'- GCACCAAGTGACAATTAGAATGC -3'

Sequencing Primer
(F):5'- GATGCCCCAGAGCTTCAGATTC -3'
(R):5'- CAATTAGAATGCAGGTGGTACTTGTC -3'
Posted On 2015-04-29