Incidental Mutation 'R4016:Ptar1'
ID311967
Institutional Source Beutler Lab
Gene Symbol Ptar1
Ensembl Gene ENSMUSG00000074925
Gene Nameprotein prenyltransferase alpha subunit repeat containing 1
Synonyms
MMRRC Submission 040847-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.930) question?
Stock #R4016 (G1)
Quality Score209
Status Validated
Chromosome19
Chromosomal Location23687400-23721129 bp(+) (GRCm38)
Type of Mutationstart codon destroyed
DNA Base Change (assembly) A to G at 23687460 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Valine at position 1 (M1V)
Ref Sequence ENSEMBL: ENSMUSP00000097156 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099560]
Predicted Effect probably null
Transcript: ENSMUST00000099560
AA Change: M1V

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000097156
Gene: ENSMUSG00000074925
AA Change: M1V

DomainStartEndE-ValueType
Pfam:PPTA 122 149 3.9e-8 PFAM
Pfam:PPTA 180 207 5e-11 PFAM
Pfam:PPTA 290 315 8e-9 PFAM
Meta Mutation Damage Score 0.9625 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 93.4%
Validation Efficiency 100% (49/49)
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aldh8a1 G A 10: 21,395,571 V399I probably benign Het
Apold1 A G 6: 134,983,906 I108V probably benign Het
Arpc5 G A 1: 152,768,856 probably benign Het
Capn11 T A 17: 45,653,756 D45V probably damaging Het
Dctpp1 G A 7: 127,257,113 R146C probably damaging Het
Dlat C T 9: 50,649,631 probably null Het
Dock10 T A 1: 80,606,569 D140V probably damaging Het
Dtx3 A G 10: 127,191,171 V378A probably benign Het
Ezh2 A G 6: 47,544,582 I414T probably benign Het
Gm1979 C T 5: 26,004,606 W41* probably null Het
Igf2bp2 T C 16: 22,063,676 N425S probably damaging Het
Kdm5a T A 6: 120,394,106 Y504N probably damaging Het
Map3k21 T A 8: 125,911,185 I170N probably damaging Het
Mrgpra6 C A 7: 47,188,715 C245F possibly damaging Het
Nipal2 T G 15: 34,600,061 K203N possibly damaging Het
Nlrp1b A G 11: 71,173,085 F621S probably damaging Het
Nos3 G A 5: 24,371,716 V448M probably damaging Het
Ntrk3 G T 7: 78,462,947 probably benign Het
Olfr1474 A T 19: 13,471,197 T76S possibly damaging Het
P2rx1 T C 11: 73,009,973 C190R probably damaging Het
Pdzrn4 T A 15: 92,399,749 D198E probably benign Het
Ptch1 T G 13: 63,524,959 E944A probably benign Het
Purg T A 8: 33,386,991 L219* probably null Het
Rbp3 G T 14: 33,955,390 V432L possibly damaging Het
Scnn1b G T 7: 121,914,332 probably null Het
Sgms1 A G 19: 32,142,792 V238A possibly damaging Het
Slc16a14 G T 1: 84,912,507 S359* probably null Het
Smarca2 G A 19: 26,683,927 probably null Het
Spatc1l A G 10: 76,562,489 S42G probably benign Het
Stra6 T A 9: 58,135,190 V34E probably damaging Het
Tex14 A G 11: 87,538,623 probably null Het
Tox4 T C 14: 52,285,904 probably null Het
Tyr A G 7: 87,437,940 S455P probably benign Het
Uggt2 T C 14: 119,026,433 N1062D possibly damaging Het
Umod A C 7: 119,476,690 N284K possibly damaging Het
Unc93b1 T C 19: 3,943,572 I338T probably damaging Het
Vmn2r99 C T 17: 19,378,570 T172I possibly damaging Het
Whrn G A 4: 63,415,639 Q415* probably null Het
Other mutations in Ptar1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01365:Ptar1 APN 19 23705801 missense probably damaging 1.00
IGL02608:Ptar1 APN 19 23705712 missense possibly damaging 0.48
R0134:Ptar1 UTSW 19 23718095 missense probably benign 0.15
R0225:Ptar1 UTSW 19 23718095 missense probably benign 0.15
R0395:Ptar1 UTSW 19 23720199 missense probably damaging 1.00
R0551:Ptar1 UTSW 19 23720340 missense probably benign 0.32
R1414:Ptar1 UTSW 19 23720291 missense possibly damaging 0.89
R3114:Ptar1 UTSW 19 23718095 missense probably benign 0.15
R4431:Ptar1 UTSW 19 23694331 missense probably damaging 1.00
R4897:Ptar1 UTSW 19 23703108 missense probably damaging 1.00
R5054:Ptar1 UTSW 19 23694365 missense probably damaging 1.00
R5660:Ptar1 UTSW 19 23694412 missense probably benign 0.32
R5928:Ptar1 UTSW 19 23717913 missense probably benign 0.00
R6333:Ptar1 UTSW 19 23694322 missense possibly damaging 0.65
R6610:Ptar1 UTSW 19 23717844 missense probably benign 0.01
R6834:Ptar1 UTSW 19 23717924 missense probably benign
R6915:Ptar1 UTSW 19 23703137 missense probably damaging 1.00
R7381:Ptar1 UTSW 19 23708970 splice site probably null
R7424:Ptar1 UTSW 19 23718101 missense probably damaging 1.00
R7563:Ptar1 UTSW 19 23720316 missense probably benign 0.00
R7884:Ptar1 UTSW 19 23708794 missense probably benign 0.03
R7967:Ptar1 UTSW 19 23708794 missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- TAAAGGCCACTCTGGGACAC -3'
(R):5'- TCTATAGCCACGCACTGGATG -3'

Sequencing Primer
(F):5'- ACGGCTGCTCGGAGAAGTG -3'
(R):5'- CACTGGATGCAACCGAGAGTC -3'
Posted On2015-04-29