Incidental Mutation 'R4016:Ptar1'
ID 311967
Institutional Source Beutler Lab
Gene Symbol Ptar1
Ensembl Gene ENSMUSG00000074925
Gene Name protein prenyltransferase alpha subunit repeat containing 1
Synonyms 4930428J16Rik, 2010013L17Rik, 1700084D09Rik
MMRRC Submission 040847-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.934) question?
Stock # R4016 (G1)
Quality Score 209
Status Validated
Chromosome 19
Chromosomal Location 23664793-23709032 bp(+) (GRCm39)
Type of Mutation start codon destroyed
DNA Base Change (assembly) A to G at 23664824 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Methionine to Valine at position 1 (M1V)
Ref Sequence ENSEMBL: ENSMUSP00000097156 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099560]
AlphaFold A0A494B9V8
Predicted Effect probably null
Transcript: ENSMUST00000099560
AA Change: M1V

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000097156
Gene: ENSMUSG00000074925
AA Change: M1V

DomainStartEndE-ValueType
Pfam:PPTA 122 149 3.9e-8 PFAM
Pfam:PPTA 180 207 5e-11 PFAM
Pfam:PPTA 290 315 8e-9 PFAM
Meta Mutation Damage Score 0.9625 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 93.4%
Validation Efficiency 100% (49/49)
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aldh8a1 G A 10: 21,271,470 (GRCm39) V399I probably benign Het
Apold1 A G 6: 134,960,869 (GRCm39) I108V probably benign Het
Arpc5 G A 1: 152,644,607 (GRCm39) probably benign Het
Capn11 T A 17: 45,964,682 (GRCm39) D45V probably damaging Het
Dctpp1 G A 7: 126,856,285 (GRCm39) R146C probably damaging Het
Dlat C T 9: 50,560,931 (GRCm39) probably null Het
Dock10 T A 1: 80,584,286 (GRCm39) D140V probably damaging Het
Dtx3 A G 10: 127,027,040 (GRCm39) V378A probably benign Het
Ezh2 A G 6: 47,521,516 (GRCm39) I414T probably benign Het
Gm1979 C T 5: 26,209,604 (GRCm39) W41* probably null Het
Igf2bp2 T C 16: 21,882,426 (GRCm39) N425S probably damaging Het
Kdm5a T A 6: 120,371,067 (GRCm39) Y504N probably damaging Het
Map3k21 T A 8: 126,637,924 (GRCm39) I170N probably damaging Het
Mrgpra6 C A 7: 46,838,463 (GRCm39) C245F possibly damaging Het
Nipal2 T G 15: 34,600,207 (GRCm39) K203N possibly damaging Het
Nlrp1b A G 11: 71,063,911 (GRCm39) F621S probably damaging Het
Nos3 G A 5: 24,576,714 (GRCm39) V448M probably damaging Het
Ntrk3 G T 7: 78,112,695 (GRCm39) probably benign Het
Or5b118 A T 19: 13,448,561 (GRCm39) T76S possibly damaging Het
P2rx1 T C 11: 72,900,799 (GRCm39) C190R probably damaging Het
Pdzrn4 T A 15: 92,297,630 (GRCm39) D198E probably benign Het
Ptch1 T G 13: 63,672,773 (GRCm39) E944A probably benign Het
Purg T A 8: 33,877,019 (GRCm39) L219* probably null Het
Rbp3 G T 14: 33,677,347 (GRCm39) V432L possibly damaging Het
Scnn1b G T 7: 121,513,555 (GRCm39) probably null Het
Sgms1 A G 19: 32,120,192 (GRCm39) V238A possibly damaging Het
Slc16a14 G T 1: 84,890,228 (GRCm39) S359* probably null Het
Smarca2 G A 19: 26,661,327 (GRCm39) probably null Het
Spatc1l A G 10: 76,398,323 (GRCm39) S42G probably benign Het
Stra6 T A 9: 58,042,473 (GRCm39) V34E probably damaging Het
Tex14 A G 11: 87,429,449 (GRCm39) probably null Het
Tox4 T C 14: 52,523,361 (GRCm39) probably null Het
Tyr A G 7: 87,087,148 (GRCm39) S455P probably benign Het
Uggt2 T C 14: 119,263,845 (GRCm39) N1062D possibly damaging Het
Umod A C 7: 119,075,913 (GRCm39) N284K possibly damaging Het
Unc93b1 T C 19: 3,993,572 (GRCm39) I338T probably damaging Het
Vmn2r99 C T 17: 19,598,832 (GRCm39) T172I possibly damaging Het
Whrn G A 4: 63,333,876 (GRCm39) Q415* probably null Het
Other mutations in Ptar1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01365:Ptar1 APN 19 23,683,165 (GRCm39) missense probably damaging 1.00
IGL02608:Ptar1 APN 19 23,683,076 (GRCm39) missense possibly damaging 0.48
R0134:Ptar1 UTSW 19 23,695,459 (GRCm39) missense probably benign 0.15
R0225:Ptar1 UTSW 19 23,695,459 (GRCm39) missense probably benign 0.15
R0395:Ptar1 UTSW 19 23,697,563 (GRCm39) missense probably damaging 1.00
R0551:Ptar1 UTSW 19 23,697,704 (GRCm39) missense probably benign 0.32
R1414:Ptar1 UTSW 19 23,697,655 (GRCm39) missense possibly damaging 0.89
R3114:Ptar1 UTSW 19 23,695,459 (GRCm39) missense probably benign 0.15
R4431:Ptar1 UTSW 19 23,671,695 (GRCm39) missense probably damaging 1.00
R4897:Ptar1 UTSW 19 23,680,472 (GRCm39) missense probably damaging 1.00
R5054:Ptar1 UTSW 19 23,671,729 (GRCm39) missense probably damaging 1.00
R5660:Ptar1 UTSW 19 23,671,776 (GRCm39) missense probably benign 0.32
R5928:Ptar1 UTSW 19 23,695,277 (GRCm39) missense probably benign 0.00
R6333:Ptar1 UTSW 19 23,671,686 (GRCm39) missense possibly damaging 0.65
R6610:Ptar1 UTSW 19 23,695,208 (GRCm39) missense probably benign 0.01
R6834:Ptar1 UTSW 19 23,695,288 (GRCm39) missense probably benign
R6915:Ptar1 UTSW 19 23,680,501 (GRCm39) missense probably damaging 1.00
R7381:Ptar1 UTSW 19 23,686,334 (GRCm39) splice site probably null
R7424:Ptar1 UTSW 19 23,695,465 (GRCm39) missense probably damaging 1.00
R7563:Ptar1 UTSW 19 23,697,680 (GRCm39) missense probably benign 0.00
R7884:Ptar1 UTSW 19 23,686,158 (GRCm39) missense probably benign 0.03
R9072:Ptar1 UTSW 19 23,695,414 (GRCm39) missense probably benign
R9331:Ptar1 UTSW 19 23,671,707 (GRCm39) missense probably benign 0.32
R9566:Ptar1 UTSW 19 23,686,206 (GRCm39) missense probably benign
Predicted Primers PCR Primer
(F):5'- TAAAGGCCACTCTGGGACAC -3'
(R):5'- TCTATAGCCACGCACTGGATG -3'

Sequencing Primer
(F):5'- ACGGCTGCTCGGAGAAGTG -3'
(R):5'- CACTGGATGCAACCGAGAGTC -3'
Posted On 2015-04-29