Incidental Mutation 'R4016:Sgms1'
List |< first << previous [record 27 of 39] next >> last >|
ID311969
Institutional Source Beutler Lab
Gene Symbol Sgms1
Ensembl Gene ENSMUSG00000040451
Gene Namesphingomyelin synthase 1
SynonymsTmem23, SMS1gamma, SMS1alpha2, SMS1, SMS1beta, SMS1alpha1, 9530058O11Rik
MMRRC Submission 040847-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.940) question?
Stock #R4016 (G1)
Quality Score225
Status Validated
Chromosome19
Chromosomal Location32122727-32389714 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 32142792 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 238 (V238A)
Ref Sequence ENSEMBL: ENSMUSP00000123395 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099514] [ENSMUST00000134415] [ENSMUST00000142618] [ENSMUST00000151289] [ENSMUST00000152340]
Predicted Effect possibly damaging
Transcript: ENSMUST00000099514
AA Change: V238A

PolyPhen 2 Score 0.883 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000097114
Gene: ENSMUSG00000040451
AA Change: V238A

DomainStartEndE-ValueType
Pfam:SAM_1 11 74 1.3e-6 PFAM
transmembrane domain 141 163 N/A INTRINSIC
transmembrane domain 186 208 N/A INTRINSIC
Pfam:PAP2 216 362 4.5e-10 PFAM
Pfam:PAP2_C 282 355 4.9e-34 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000134415
SMART Domains Protein: ENSMUSP00000115785
Gene: ENSMUSG00000040451

DomainStartEndE-ValueType
Pfam:SAM_1 11 74 4.3e-7 PFAM
transmembrane domain 141 163 N/A INTRINSIC
transmembrane domain 188 210 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000142618
AA Change: V238A

PolyPhen 2 Score 0.883 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000117336
Gene: ENSMUSG00000040451
AA Change: V238A

DomainStartEndE-ValueType
Pfam:SAM_1 11 74 1.3e-6 PFAM
transmembrane domain 141 163 N/A INTRINSIC
transmembrane domain 186 208 N/A INTRINSIC
Pfam:PAP2 216 362 4.5e-10 PFAM
Pfam:PAP2_C 282 355 4.9e-34 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000151289
AA Change: V238A

PolyPhen 2 Score 0.883 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000123395
Gene: ENSMUSG00000040451
AA Change: V238A

DomainStartEndE-ValueType
Pfam:SAM_1 11 74 1.5e-6 PFAM
transmembrane domain 141 163 N/A INTRINSIC
transmembrane domain 186 208 N/A INTRINSIC
transmembrane domain 221 243 N/A INTRINSIC
Pfam:PAP2_C 282 355 1.7e-30 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000152340
SMART Domains Protein: ENSMUSP00000119869
Gene: ENSMUSG00000040451

DomainStartEndE-ValueType
Pfam:SAM_1 11 74 4.7e-7 PFAM
transmembrane domain 141 163 N/A INTRINSIC
transmembrane domain 188 210 N/A INTRINSIC
Meta Mutation Damage Score 0.0733 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 93.4%
Validation Efficiency 100% (49/49)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is predicted to be a five-pass transmembrane protein. This gene may be predominately expressed in brain. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit premature death, impaired insulin tolerance, increased insulin sensitivity, decreased insulin secretion, and abnormal pancreatic islet cell mitochondria morphology. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aldh8a1 G A 10: 21,395,571 V399I probably benign Het
Apold1 A G 6: 134,983,906 I108V probably benign Het
Arpc5 G A 1: 152,768,856 probably benign Het
Capn11 T A 17: 45,653,756 D45V probably damaging Het
Dctpp1 G A 7: 127,257,113 R146C probably damaging Het
Dlat C T 9: 50,649,631 probably null Het
Dock10 T A 1: 80,606,569 D140V probably damaging Het
Dtx3 A G 10: 127,191,171 V378A probably benign Het
Ezh2 A G 6: 47,544,582 I414T probably benign Het
Gm1979 C T 5: 26,004,606 W41* probably null Het
Igf2bp2 T C 16: 22,063,676 N425S probably damaging Het
Kdm5a T A 6: 120,394,106 Y504N probably damaging Het
Map3k21 T A 8: 125,911,185 I170N probably damaging Het
Mrgpra6 C A 7: 47,188,715 C245F possibly damaging Het
Nipal2 T G 15: 34,600,061 K203N possibly damaging Het
Nlrp1b A G 11: 71,173,085 F621S probably damaging Het
Nos3 G A 5: 24,371,716 V448M probably damaging Het
Ntrk3 G T 7: 78,462,947 probably benign Het
Olfr1474 A T 19: 13,471,197 T76S possibly damaging Het
P2rx1 T C 11: 73,009,973 C190R probably damaging Het
Pdzrn4 T A 15: 92,399,749 D198E probably benign Het
Ptar1 A G 19: 23,687,460 M1V probably null Het
Ptch1 T G 13: 63,524,959 E944A probably benign Het
Purg T A 8: 33,386,991 L219* probably null Het
Rbp3 G T 14: 33,955,390 V432L possibly damaging Het
Scnn1b G T 7: 121,914,332 probably null Het
Slc16a14 G T 1: 84,912,507 S359* probably null Het
Smarca2 G A 19: 26,683,927 probably null Het
Spatc1l A G 10: 76,562,489 S42G probably benign Het
Stra6 T A 9: 58,135,190 V34E probably damaging Het
Tex14 A G 11: 87,538,623 probably null Het
Tox4 T C 14: 52,285,904 probably null Het
Tyr A G 7: 87,437,940 S455P probably benign Het
Uggt2 T C 14: 119,026,433 N1062D possibly damaging Het
Umod A C 7: 119,476,690 N284K possibly damaging Het
Unc93b1 T C 19: 3,943,572 I338T probably damaging Het
Vmn2r99 C T 17: 19,378,570 T172I possibly damaging Het
Whrn G A 4: 63,415,639 Q415* probably null Het
Other mutations in Sgms1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00486:Sgms1 APN 19 32159625 missense probably damaging 1.00
IGL01585:Sgms1 APN 19 32142845 missense probably damaging 1.00
IGL02490:Sgms1 APN 19 32160143 missense probably damaging 0.98
IGL02970:Sgms1 APN 19 32159765 missense probably damaging 0.99
R1051:Sgms1 UTSW 19 32160039 missense probably damaging 1.00
R1871:Sgms1 UTSW 19 32159882 missense probably benign 0.01
R1971:Sgms1 UTSW 19 32159957 missense probably benign 0.05
R2001:Sgms1 UTSW 19 32159683 missense possibly damaging 0.94
R2404:Sgms1 UTSW 19 32159672 nonsense probably null
R2405:Sgms1 UTSW 19 32159672 nonsense probably null
R2408:Sgms1 UTSW 19 32159672 nonsense probably null
R2410:Sgms1 UTSW 19 32159672 nonsense probably null
R3747:Sgms1 UTSW 19 32159594 missense possibly damaging 0.65
R4710:Sgms1 UTSW 19 32160137 missense probably damaging 1.00
R5056:Sgms1 UTSW 19 32159687 missense probably damaging 1.00
R5422:Sgms1 UTSW 19 32159832 missense probably damaging 0.98
R6023:Sgms1 UTSW 19 32124373 missense probably benign 0.12
R6106:Sgms1 UTSW 19 32124425 missense possibly damaging 0.87
R6932:Sgms1 UTSW 19 32142793 missense probably benign 0.02
R7207:Sgms1 UTSW 19 32142747 missense probably null 1.00
R7382:Sgms1 UTSW 19 32159782 missense possibly damaging 0.68
R7494:Sgms1 UTSW 19 32129691 missense probably benign 0.00
R7712:Sgms1 UTSW 19 32142769 missense probably benign 0.05
R7759:Sgms1 UTSW 19 32159876 missense probably benign
R7872:Sgms1 UTSW 19 32125365 missense probably damaging 0.99
R7955:Sgms1 UTSW 19 32125365 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- AATTCTGAGAAGGGCGTGGC -3'
(R):5'- TGTAGCACTCTGATTTCAAGCTC -3'

Sequencing Primer
(F):5'- CTCTCTGGTCCTATAGCTTAGGGAC -3'
(R):5'- CAAGCTCTTGACTAGATTTCTGGG -3'
Posted On2015-04-29