Incidental Mutation 'R4017:Olfr1112'
ID311977
Institutional Source Beutler Lab
Gene Symbol Olfr1112
Ensembl Gene ENSMUSG00000044487
Gene Nameolfactory receptor 1112
SynonymsGA_x6K02T2Q125-48676316-48677272, MOR264-6
MMRRC Submission 041611-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.061) question?
Stock #R4017 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location87187798-87192767 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 87192502 bp
ZygosityHeterozygous
Amino Acid Change Serine to Glycine at position 272 (S272G)
Ref Sequence ENSEMBL: ENSMUSP00000149960 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000053050] [ENSMUST00000216772]
Predicted Effect probably benign
Transcript: ENSMUST00000053050
AA Change: S272G

PolyPhen 2 Score 0.029 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000052341
Gene: ENSMUSG00000044487
AA Change: S272G

DomainStartEndE-ValueType
Pfam:7tm_4 38 315 2.4e-52 PFAM
Pfam:7tm_1 48 297 1.4e-22 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000216772
AA Change: S272G

PolyPhen 2 Score 0.029 (Sensitivity: 0.95; Specificity: 0.82)
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 93.8%
Validation Efficiency 97% (36/37)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Actn3 G T 19: 4,867,546 T423N possibly damaging Het
Apold1 A G 6: 134,983,906 I108V probably benign Het
Arhgap21 G T 2: 20,892,104 F121L probably benign Het
BC004004 T C 17: 29,298,732 S307P probably damaging Het
Cpeb4 A G 11: 31,924,671 D484G probably damaging Het
Dctpp1 G A 7: 127,257,113 R146C probably damaging Het
Dnm2 A G 9: 21,494,604 Y553C probably damaging Het
Dync1h1 G T 12: 110,643,190 R2802I probably damaging Het
Eif2a T A 3: 58,545,355 M209K probably damaging Het
Epb41 A T 4: 131,982,445 probably benign Het
Fnip1 A G 11: 54,509,987 K1071E probably benign Het
Igf2bp2 T C 16: 22,063,676 N425S probably damaging Het
Kdm5a T A 6: 120,394,106 Y504N probably damaging Het
Kif1a T C 1: 93,076,292 D156G probably damaging Het
Klhl10 G A 11: 100,445,674 M162I probably benign Het
Lrp1b A G 2: 40,802,984 F3401L possibly damaging Het
Lrp6 G T 6: 134,520,550 R165S probably damaging Het
Muc5b G A 7: 141,863,630 V3438M probably benign Het
Myo3a A G 2: 22,578,170 R479G possibly damaging Het
Npr1 T C 3: 90,456,232 E828G probably damaging Het
Obscn A G 11: 59,132,622 F643S probably damaging Het
Olfr748 A T 14: 50,710,876 D182V probably benign Het
Pcdhga8 T C 18: 37,815,738 V69A probably damaging Het
Ppp6r1 C A 7: 4,633,744 C688F probably benign Het
Ptch1 T G 13: 63,524,959 E944A probably benign Het
Rnf157 A T 11: 116,359,241 probably null Het
Saxo1 A T 4: 86,557,996 I7N possibly damaging Het
Scn7a A T 2: 66,741,985 I214N probably damaging Het
Setx GTGGCT GT 2: 29,154,061 probably null Het
Suz12 G T 11: 80,013,466 V211F probably damaging Het
Trim9 G A 12: 70,346,352 H273Y probably damaging Het
Uggt2 T C 14: 119,026,433 N1062D possibly damaging Het
Wdr70 A T 15: 8,079,214 C149* probably null Het
Zfp940 T C 7: 29,845,934 I183V probably benign Het
Other mutations in Olfr1112
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01453:Olfr1112 APN 2 87191848 missense probably benign 0.00
R0665:Olfr1112 UTSW 2 87192308 missense probably damaging 1.00
R1698:Olfr1112 UTSW 2 87191737 missense probably benign 0.00
R1717:Olfr1112 UTSW 2 87191903 missense probably benign 0.38
R1768:Olfr1112 UTSW 2 87191698 missense probably benign
R1872:Olfr1112 UTSW 2 87191878 missense possibly damaging 0.96
R3441:Olfr1112 UTSW 2 87191818 missense probably benign 0.00
R4895:Olfr1112 UTSW 2 87191848 missense probably benign 0.00
R5451:Olfr1112 UTSW 2 87192452 missense probably damaging 1.00
R6171:Olfr1112 UTSW 2 87192365 missense possibly damaging 0.77
R6851:Olfr1112 UTSW 2 87192469 missense probably benign 0.37
R7263:Olfr1112 UTSW 2 87192132 nonsense probably null
R7622:Olfr1112 UTSW 2 87192250 missense probably benign 0.01
R7659:Olfr1112 UTSW 2 87192365 missense possibly damaging 0.77
R7798:Olfr1112 UTSW 2 87192292 missense probably benign 0.00
R7880:Olfr1112 UTSW 2 87192090 nonsense probably null
R7963:Olfr1112 UTSW 2 87192090 nonsense probably null
Predicted Primers PCR Primer
(F):5'- AGTCCTGACCCTAGCTTGTG -3'
(R):5'- CCAAGAATTAGGAGAACTGTGCATG -3'

Sequencing Primer
(F):5'- GGGACACTTTTATGATAGAGATGC -3'
(R):5'- TTAGGAGAACTGTGCATGACAATG -3'
Posted On2015-04-29