Incidental Mutation 'R4017:Eif2a'
ID311978
Institutional Source Beutler Lab
Gene Symbol Eif2a
Ensembl Gene ENSMUSG00000027810
Gene Nameeukaryotic translation initiation factor 2A
SynonymsD3Ertd194e
MMRRC Submission 041611-MU
Accession Numbers

Genbank: NM_001005509.2; Ensembl: ENSMUST00000029387

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4017 (G1)
Quality Score225
Status Validated
Chromosome3
Chromosomal Location58525821-58557501 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 58545355 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Lysine at position 209 (M209K)
Ref Sequence ENSEMBL: ENSMUSP00000120901 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029387] [ENSMUST00000135876] [ENSMUST00000138848] [ENSMUST00000154219]
Predicted Effect probably damaging
Transcript: ENSMUST00000029387
AA Change: M226K

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000029387
Gene: ENSMUSG00000027810
AA Change: M226K

DomainStartEndE-ValueType
low complexity region 145 159 N/A INTRINSIC
Pfam:eIF2A 216 411 1e-77 PFAM
low complexity region 488 502 N/A INTRINSIC
coiled coil region 528 575 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000135876
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137469
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138827
Predicted Effect probably damaging
Transcript: ENSMUST00000138848
AA Change: M209K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000120901
Gene: ENSMUSG00000027810
AA Change: M209K

DomainStartEndE-ValueType
SCOP:d1kb0a2 27 160 5e-9 SMART
Pfam:eIF2A 199 251 1.5e-16 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148251
Predicted Effect probably benign
Transcript: ENSMUST00000154219
Meta Mutation Damage Score 0.8465 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 93.8%
Validation Efficiency 97% (36/37)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a eukaryotic translation initiation factor that catalyzes the formation of puromycin-sensitive 80 S preinitiation complexes and the poly(U)-directed synthesis of polyphenylalanine at low concentrations of Mg2+. This gene should not be confused with eIF2-alpha (EIF2S1, Gene ID: 1965), the alpha subunit of the eIF2 translation initiation complex. Although both of these proteins function in binding initiator tRNA to the 40 S ribosomal subunit, the encoded protein does so in a codon-dependent manner, whereas eIF2 complex requires GTP. Alternative splicing of this gene results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Jan 2016]
PHENOTYPE: Mice homozygous for a null allele are viable and fertile with no visible phenotypes. [provided by MGI curators]
Allele List at MGI

All alleles(51) : Targeted, other(2) Gene trapped(49)

Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Actn3 G T 19: 4,867,546 T423N possibly damaging Het
Apold1 A G 6: 134,983,906 I108V probably benign Het
Arhgap21 G T 2: 20,892,104 F121L probably benign Het
BC004004 T C 17: 29,298,732 S307P probably damaging Het
Cpeb4 A G 11: 31,924,671 D484G probably damaging Het
Dctpp1 G A 7: 127,257,113 R146C probably damaging Het
Dnm2 A G 9: 21,494,604 Y553C probably damaging Het
Dync1h1 G T 12: 110,643,190 R2802I probably damaging Het
Epb41 A T 4: 131,982,445 probably benign Het
Fnip1 A G 11: 54,509,987 K1071E probably benign Het
Igf2bp2 T C 16: 22,063,676 N425S probably damaging Het
Kdm5a T A 6: 120,394,106 Y504N probably damaging Het
Kif1a T C 1: 93,076,292 D156G probably damaging Het
Klhl10 G A 11: 100,445,674 M162I probably benign Het
Lrp1b A G 2: 40,802,984 F3401L possibly damaging Het
Lrp6 G T 6: 134,520,550 R165S probably damaging Het
Muc5b G A 7: 141,863,630 V3438M probably benign Het
Myo3a A G 2: 22,578,170 R479G possibly damaging Het
Npr1 T C 3: 90,456,232 E828G probably damaging Het
Obscn A G 11: 59,132,622 F643S probably damaging Het
Olfr1112 A G 2: 87,192,502 S272G probably benign Het
Olfr748 A T 14: 50,710,876 D182V probably benign Het
Pcdhga8 T C 18: 37,815,738 V69A probably damaging Het
Ppp6r1 C A 7: 4,633,744 C688F probably benign Het
Ptch1 T G 13: 63,524,959 E944A probably benign Het
Rnf157 A T 11: 116,359,241 probably null Het
Saxo1 A T 4: 86,557,996 I7N possibly damaging Het
Scn7a A T 2: 66,741,985 I214N probably damaging Het
Setx GTGGCT GT 2: 29,154,061 probably null Het
Suz12 G T 11: 80,013,466 V211F probably damaging Het
Trim9 G A 12: 70,346,352 H273Y probably damaging Het
Uggt2 T C 14: 119,026,433 N1062D possibly damaging Het
Wdr70 A T 15: 8,079,214 C149* probably null Het
Zfp940 T C 7: 29,845,934 I183V probably benign Het
Other mutations in Eif2a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02323:Eif2a APN 3 58548603 missense possibly damaging 0.89
IGL02823:Eif2a APN 3 58548671 missense probably benign 0.01
IGL03086:Eif2a APN 3 58541117 missense probably benign 0.00
IGL03165:Eif2a APN 3 58548628 nonsense probably null
1mM(1):Eif2a UTSW 3 58545303 missense possibly damaging 0.75
PIT4576001:Eif2a UTSW 3 58545553 missense probably damaging 1.00
R0540:Eif2a UTSW 3 58555652 critical splice donor site probably null
R0607:Eif2a UTSW 3 58555652 critical splice donor site probably null
R1061:Eif2a UTSW 3 58545065 nonsense probably null
R1499:Eif2a UTSW 3 58537584 nonsense probably null
R1922:Eif2a UTSW 3 58548530 missense probably damaging 1.00
R3980:Eif2a UTSW 3 58539539 missense probably benign 0.00
R4080:Eif2a UTSW 3 58539629 missense possibly damaging 0.52
R5528:Eif2a UTSW 3 58548512 missense probably damaging 1.00
R6320:Eif2a UTSW 3 58557096 intron probably null
R7081:Eif2a UTSW 3 58541718 critical splice donor site probably null
R7414:Eif2a UTSW 3 58526081 nonsense probably null
R7447:Eif2a UTSW 3 58545542 missense probably damaging 0.97
R7497:Eif2a UTSW 3 58548681 missense probably damaging 1.00
R7701:Eif2a UTSW 3 58552570 missense possibly damaging 0.72
Predicted Primers PCR Primer
(F):5'- CCATCTCAGTTTATGTGCTTCTAAG -3'
(R):5'- CAATGTAGTGCAGTGTTTGTTCTCC -3'

Sequencing Primer
(F):5'- TGTGCTTCTAAGAATTAAGCACTG -3'
(R):5'- GGAGGCTCCTGTCTTGTCAAC -3'
Posted On2015-04-29