Incidental Mutation 'R4017:Saxo1'
ID311980
Institutional Source Beutler Lab
Gene Symbol Saxo1
Ensembl Gene ENSMUSG00000028492
Gene Namestabilizer of axonemal microtubules 1
Synonyms4930500O09Rik, Fam154a
MMRRC Submission 041611-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.065) question?
Stock #R4017 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location86444641-86558328 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 86557996 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Asparagine at position 7 (I7N)
Ref Sequence ENSEMBL: ENSMUSP00000030216 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030216]
Predicted Effect possibly damaging
Transcript: ENSMUST00000030216
AA Change: I7N

PolyPhen 2 Score 0.819 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000030216
Gene: ENSMUSG00000028492
AA Change: I7N

DomainStartEndE-ValueType
Pfam:STOP 5 129 2.4e-13 PFAM
Pfam:STOP 88 265 1.6e-19 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131790
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133793
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139694
Meta Mutation Damage Score 0.3742 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 93.8%
Validation Efficiency 97% (36/37)
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Actn3 G T 19: 4,867,546 T423N possibly damaging Het
Apold1 A G 6: 134,983,906 I108V probably benign Het
Arhgap21 G T 2: 20,892,104 F121L probably benign Het
BC004004 T C 17: 29,298,732 S307P probably damaging Het
Cpeb4 A G 11: 31,924,671 D484G probably damaging Het
Dctpp1 G A 7: 127,257,113 R146C probably damaging Het
Dnm2 A G 9: 21,494,604 Y553C probably damaging Het
Dync1h1 G T 12: 110,643,190 R2802I probably damaging Het
Eif2a T A 3: 58,545,355 M209K probably damaging Het
Epb41 A T 4: 131,982,445 probably benign Het
Fnip1 A G 11: 54,509,987 K1071E probably benign Het
Igf2bp2 T C 16: 22,063,676 N425S probably damaging Het
Kdm5a T A 6: 120,394,106 Y504N probably damaging Het
Kif1a T C 1: 93,076,292 D156G probably damaging Het
Klhl10 G A 11: 100,445,674 M162I probably benign Het
Lrp1b A G 2: 40,802,984 F3401L possibly damaging Het
Lrp6 G T 6: 134,520,550 R165S probably damaging Het
Muc5b G A 7: 141,863,630 V3438M probably benign Het
Myo3a A G 2: 22,578,170 R479G possibly damaging Het
Npr1 T C 3: 90,456,232 E828G probably damaging Het
Obscn A G 11: 59,132,622 F643S probably damaging Het
Olfr1112 A G 2: 87,192,502 S272G probably benign Het
Olfr748 A T 14: 50,710,876 D182V probably benign Het
Pcdhga8 T C 18: 37,815,738 V69A probably damaging Het
Ppp6r1 C A 7: 4,633,744 C688F probably benign Het
Ptch1 T G 13: 63,524,959 E944A probably benign Het
Rnf157 A T 11: 116,359,241 probably null Het
Scn7a A T 2: 66,741,985 I214N probably damaging Het
Setx GTGGCT GT 2: 29,154,061 probably null Het
Suz12 G T 11: 80,013,466 V211F probably damaging Het
Trim9 G A 12: 70,346,352 H273Y probably damaging Het
Uggt2 T C 14: 119,026,433 N1062D possibly damaging Het
Wdr70 A T 15: 8,079,214 C149* probably null Het
Zfp940 T C 7: 29,845,934 I183V probably benign Het
Other mutations in Saxo1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00562:Saxo1 APN 4 86445572 missense probably damaging 1.00
IGL00563:Saxo1 APN 4 86445572 missense probably damaging 1.00
IGL01816:Saxo1 APN 4 86445614 missense probably benign 0.03
IGL02941:Saxo1 APN 4 86445584 missense probably damaging 1.00
IGL03139:Saxo1 APN 4 86487762 missense possibly damaging 0.49
R0498:Saxo1 UTSW 4 86478896 missense possibly damaging 0.78
R0522:Saxo1 UTSW 4 86445103 missense probably damaging 1.00
R1126:Saxo1 UTSW 4 86478987 missense probably benign 0.30
R2203:Saxo1 UTSW 4 86445761 missense probably damaging 1.00
R2261:Saxo1 UTSW 4 86478975 missense probably damaging 1.00
R2262:Saxo1 UTSW 4 86478975 missense probably damaging 1.00
R4629:Saxo1 UTSW 4 86487827 missense probably damaging 1.00
R5199:Saxo1 UTSW 4 86487782 missense probably damaging 1.00
R5471:Saxo1 UTSW 4 86445724 missense probably damaging 1.00
R5626:Saxo1 UTSW 4 86445589 missense probably damaging 1.00
R5679:Saxo1 UTSW 4 86445035 missense possibly damaging 0.89
R5710:Saxo1 UTSW 4 86445035 missense possibly damaging 0.89
R5782:Saxo1 UTSW 4 86445807 missense probably damaging 0.96
R6900:Saxo1 UTSW 4 86445334 missense possibly damaging 0.94
R7035:Saxo1 UTSW 4 86445122 missense probably damaging 1.00
R7491:Saxo1 UTSW 4 86445407 missense probably benign 0.27
Predicted Primers PCR Primer
(F):5'- AAACCCGAATCCAGTGCGATG -3'
(R):5'- CAGCAGCTTACAGACGTGAG -3'

Sequencing Primer
(F):5'- ATCCAGTGCGATGCTGCCTAG -3'
(R):5'- TGCCTGTTTGCCCAAGG -3'
Posted On2015-04-29