Incidental Mutation 'R4017:Ppp6r1'
ID311987
Institutional Source Beutler Lab
Gene Symbol Ppp6r1
Ensembl Gene ENSMUSG00000052296
Gene Nameprotein phosphatase 6, regulatory subunit 1
SynonymsB430201G11Rik, Saps1, 2010309P17Rik, Pp6r1
MMRRC Submission 041611-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.118) question?
Stock #R4017 (G1)
Quality Score142
Status Validated
Chromosome7
Chromosomal Location4631495-4659019 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 4633744 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Phenylalanine at position 688 (C688F)
Ref Sequence ENSEMBL: ENSMUSP00000066736 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000055085] [ENSMUST00000064099] [ENSMUST00000205360] [ENSMUST00000205402] [ENSMUST00000206610]
Predicted Effect probably benign
Transcript: ENSMUST00000055085
SMART Domains Protein: ENSMUSP00000060237
Gene: ENSMUSG00000045282

DomainStartEndE-ValueType
transmembrane domain 21 40 N/A INTRINSIC
Pfam:YhhN 47 217 1.2e-41 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000064099
AA Change: C688F

PolyPhen 2 Score 0.071 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000066736
Gene: ENSMUSG00000052296
AA Change: C688F

DomainStartEndE-ValueType
low complexity region 16 36 N/A INTRINSIC
Pfam:SAPS 128 378 4.6e-69 PFAM
Pfam:SAPS 372 519 1.8e-39 PFAM
low complexity region 525 536 N/A INTRINSIC
low complexity region 618 639 N/A INTRINSIC
low complexity region 669 681 N/A INTRINSIC
low complexity region 692 707 N/A INTRINSIC
low complexity region 842 855 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000205360
Predicted Effect probably benign
Transcript: ENSMUST00000205402
Predicted Effect noncoding transcript
Transcript: ENSMUST00000206307
Predicted Effect noncoding transcript
Transcript: ENSMUST00000206485
Predicted Effect probably benign
Transcript: ENSMUST00000206610
Predicted Effect noncoding transcript
Transcript: ENSMUST00000206768
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 93.8%
Validation Efficiency 97% (36/37)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Protein phosphatase regulatory subunits, such as SAPS1, modulate the activity of protein phosphatase catalytic subunits by restricting substrate specificity, recruiting substrates, and determining the intracellular localization of the holoenzyme. SAPS1 is a regulatory subunit for the protein phosphatase-6 catalytic subunit (PPP6C; MIM 612725) (Stefansson and Brautigan, 2006 [PubMed 16769727]).[supplied by OMIM, Nov 2010]
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Actn3 G T 19: 4,867,546 T423N possibly damaging Het
Apold1 A G 6: 134,983,906 I108V probably benign Het
Arhgap21 G T 2: 20,892,104 F121L probably benign Het
BC004004 T C 17: 29,298,732 S307P probably damaging Het
Cpeb4 A G 11: 31,924,671 D484G probably damaging Het
Dctpp1 G A 7: 127,257,113 R146C probably damaging Het
Dnm2 A G 9: 21,494,604 Y553C probably damaging Het
Dync1h1 G T 12: 110,643,190 R2802I probably damaging Het
Eif2a T A 3: 58,545,355 M209K probably damaging Het
Epb41 A T 4: 131,982,445 probably benign Het
Fnip1 A G 11: 54,509,987 K1071E probably benign Het
Igf2bp2 T C 16: 22,063,676 N425S probably damaging Het
Kdm5a T A 6: 120,394,106 Y504N probably damaging Het
Kif1a T C 1: 93,076,292 D156G probably damaging Het
Klhl10 G A 11: 100,445,674 M162I probably benign Het
Lrp1b A G 2: 40,802,984 F3401L possibly damaging Het
Lrp6 G T 6: 134,520,550 R165S probably damaging Het
Muc5b G A 7: 141,863,630 V3438M probably benign Het
Myo3a A G 2: 22,578,170 R479G possibly damaging Het
Npr1 T C 3: 90,456,232 E828G probably damaging Het
Obscn A G 11: 59,132,622 F643S probably damaging Het
Olfr1112 A G 2: 87,192,502 S272G probably benign Het
Olfr748 A T 14: 50,710,876 D182V probably benign Het
Pcdhga8 T C 18: 37,815,738 V69A probably damaging Het
Ptch1 T G 13: 63,524,959 E944A probably benign Het
Rnf157 A T 11: 116,359,241 probably null Het
Saxo1 A T 4: 86,557,996 I7N possibly damaging Het
Scn7a A T 2: 66,741,985 I214N probably damaging Het
Setx GTGGCT GT 2: 29,154,061 probably null Het
Suz12 G T 11: 80,013,466 V211F probably damaging Het
Trim9 G A 12: 70,346,352 H273Y probably damaging Het
Uggt2 T C 14: 119,026,433 N1062D possibly damaging Het
Wdr70 A T 15: 8,079,214 C149* probably null Het
Zfp940 T C 7: 29,845,934 I183V probably benign Het
Other mutations in Ppp6r1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01883:Ppp6r1 APN 7 4639987 splice site probably null
IGL02232:Ppp6r1 APN 7 4633342 missense probably damaging 0.98
IGL02674:Ppp6r1 APN 7 4646813 missense probably damaging 1.00
IGL02887:Ppp6r1 APN 7 4642212 missense probably damaging 1.00
IGL02990:Ppp6r1 APN 7 4643023 missense possibly damaging 0.83
IGL03135:Ppp6r1 APN 7 4642160 missense possibly damaging 0.90
IGL03399:Ppp6r1 APN 7 4643252 missense probably damaging 1.00
R0375:Ppp6r1 UTSW 7 4633287 missense probably benign 0.00
R0412:Ppp6r1 UTSW 7 4642214 missense probably damaging 0.98
R0760:Ppp6r1 UTSW 7 4639723 missense probably benign 0.00
R0883:Ppp6r1 UTSW 7 4639710 missense possibly damaging 0.89
R1478:Ppp6r1 UTSW 7 4640378 splice site probably null
R1515:Ppp6r1 UTSW 7 4643258 missense probably damaging 0.97
R1768:Ppp6r1 UTSW 7 4633692 critical splice donor site probably null
R1772:Ppp6r1 UTSW 7 4642031 missense probably benign 0.00
R4519:Ppp6r1 UTSW 7 4641046 unclassified probably null
R4795:Ppp6r1 UTSW 7 4641054 missense possibly damaging 0.66
R4849:Ppp6r1 UTSW 7 4643207 missense probably damaging 1.00
R5214:Ppp6r1 UTSW 7 4643177 missense probably benign 0.00
R5416:Ppp6r1 UTSW 7 4639748 missense possibly damaging 0.96
R5643:Ppp6r1 UTSW 7 4633772 missense probably benign 0.30
R5765:Ppp6r1 UTSW 7 4642208 missense possibly damaging 0.67
R6126:Ppp6r1 UTSW 7 4643377 missense possibly damaging 0.48
R6854:Ppp6r1 UTSW 7 4632396 missense probably benign 0.02
R6932:Ppp6r1 UTSW 7 4633292 missense possibly damaging 0.84
R7011:Ppp6r1 UTSW 7 4646826 missense probably damaging 1.00
R7486:Ppp6r1 UTSW 7 4639900 missense probably benign 0.17
R7500:Ppp6r1 UTSW 7 4636130 missense probably benign 0.04
X0062:Ppp6r1 UTSW 7 4640307 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- GTCTGCCTCCTTAGAAACTGGG -3'
(R):5'- TCCCTAGAGGCCTTTGTTCG -3'

Sequencing Primer
(F):5'- TCCATAGGCACTGTGTCAAAG -3'
(R):5'- CGCCATGTCTGTGGTCCTG -3'
Posted On2015-04-29