Incidental Mutation 'R4017:Zfp940'
ID311989
Institutional Source Beutler Lab
Gene Symbol Zfp940
Ensembl Gene ENSMUSG00000050855
Gene Namezinc finger protein 940
SynonymsBC027344
MMRRC Submission 041611-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4017 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location29833620-29853669 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 29845934 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 183 (I183V)
Ref Sequence ENSEMBL: ENSMUSP00000082947 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000085792] [ENSMUST00000108223]
Predicted Effect probably benign
Transcript: ENSMUST00000085792
AA Change: I183V

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000082947
Gene: ENSMUSG00000050855
AA Change: I183V

DomainStartEndE-ValueType
KRAB 6 66 1.05e-31 SMART
ZnF_C2H2 251 273 3.69e-4 SMART
ZnF_C2H2 279 301 5.5e-3 SMART
ZnF_C2H2 307 329 7.67e-2 SMART
ZnF_C2H2 340 362 2.71e-2 SMART
ZnF_C2H2 368 390 5.34e-1 SMART
ZnF_C2H2 396 418 1.38e-3 SMART
ZnF_C2H2 424 446 3.39e-3 SMART
ZnF_C2H2 452 474 6.78e-3 SMART
ZnF_C2H2 485 507 4.79e-3 SMART
ZnF_C2H2 513 535 2.24e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000108223
SMART Domains Protein: ENSMUSP00000103858
Gene: ENSMUSG00000050855

DomainStartEndE-ValueType
KRAB 6 67 2.42e-22 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145098
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 93.8%
Validation Efficiency 97% (36/37)
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Actn3 G T 19: 4,867,546 T423N possibly damaging Het
Apold1 A G 6: 134,983,906 I108V probably benign Het
Arhgap21 G T 2: 20,892,104 F121L probably benign Het
BC004004 T C 17: 29,298,732 S307P probably damaging Het
Cpeb4 A G 11: 31,924,671 D484G probably damaging Het
Dctpp1 G A 7: 127,257,113 R146C probably damaging Het
Dnm2 A G 9: 21,494,604 Y553C probably damaging Het
Dync1h1 G T 12: 110,643,190 R2802I probably damaging Het
Eif2a T A 3: 58,545,355 M209K probably damaging Het
Epb41 A T 4: 131,982,445 probably benign Het
Fnip1 A G 11: 54,509,987 K1071E probably benign Het
Igf2bp2 T C 16: 22,063,676 N425S probably damaging Het
Kdm5a T A 6: 120,394,106 Y504N probably damaging Het
Kif1a T C 1: 93,076,292 D156G probably damaging Het
Klhl10 G A 11: 100,445,674 M162I probably benign Het
Lrp1b A G 2: 40,802,984 F3401L possibly damaging Het
Lrp6 G T 6: 134,520,550 R165S probably damaging Het
Muc5b G A 7: 141,863,630 V3438M probably benign Het
Myo3a A G 2: 22,578,170 R479G possibly damaging Het
Npr1 T C 3: 90,456,232 E828G probably damaging Het
Obscn A G 11: 59,132,622 F643S probably damaging Het
Olfr1112 A G 2: 87,192,502 S272G probably benign Het
Olfr748 A T 14: 50,710,876 D182V probably benign Het
Pcdhga8 T C 18: 37,815,738 V69A probably damaging Het
Ppp6r1 C A 7: 4,633,744 C688F probably benign Het
Ptch1 T G 13: 63,524,959 E944A probably benign Het
Rnf157 A T 11: 116,359,241 probably null Het
Saxo1 A T 4: 86,557,996 I7N possibly damaging Het
Scn7a A T 2: 66,741,985 I214N probably damaging Het
Setx GTGGCT GT 2: 29,154,061 probably null Het
Suz12 G T 11: 80,013,466 V211F probably damaging Het
Trim9 G A 12: 70,346,352 H273Y probably damaging Het
Uggt2 T C 14: 119,026,433 N1062D possibly damaging Het
Wdr70 A T 15: 8,079,214 C149* probably null Het
Other mutations in Zfp940
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01941:Zfp940 APN 7 29846870 missense probably damaging 1.00
IGL02092:Zfp940 APN 7 29846201 missense probably benign
IGL02498:Zfp940 APN 7 29846951 missense probably damaging 0.97
R0503:Zfp940 UTSW 7 29846020 intron probably benign
R0614:Zfp940 UTSW 7 29846246 missense probably benign 0.03
R1604:Zfp940 UTSW 7 29846075 missense probably benign
R1619:Zfp940 UTSW 7 29845537 missense possibly damaging 0.85
R1715:Zfp940 UTSW 7 29844938 missense probably damaging 0.96
R1749:Zfp940 UTSW 7 29845527 nonsense probably null
R1862:Zfp940 UTSW 7 29845010 missense probably damaging 1.00
R4673:Zfp940 UTSW 7 29845438 missense probably benign 0.00
R4761:Zfp940 UTSW 7 29846153 missense probably benign 0.12
R4890:Zfp940 UTSW 7 29845399 missense probably benign 0.01
R5027:Zfp940 UTSW 7 29850956 utr 5 prime probably benign
R5285:Zfp940 UTSW 7 29845600 missense probably damaging 0.99
R5340:Zfp940 UTSW 7 29844841 missense probably benign 0.33
R5439:Zfp940 UTSW 7 29845433 missense probably benign 0.02
R5983:Zfp940 UTSW 7 29845052 missense possibly damaging 0.96
R7873:Zfp940 UTSW 7 29835617 missense unknown
R7956:Zfp940 UTSW 7 29835617 missense unknown
R8035:Zfp940 UTSW 7 29845523 missense not run
Predicted Primers PCR Primer
(F):5'- TTGCGGAAGGCCCAGTATTC -3'
(R):5'- GAAAACGCAGTCTTGAAGATTTCTG -3'

Sequencing Primer
(F):5'- AAGGCCCAGTATTCCTGAAGGC -3'
(R):5'- CTGGGATGGCAAAAATCAGTTTC -3'
Posted On2015-04-29