Incidental Mutation 'R0385:Fastkd2'
ID31199
Institutional Source Beutler Lab
Gene Symbol Fastkd2
Ensembl Gene ENSMUSG00000025962
Gene NameFAST kinase domains 2
Synonyms2810421I24Rik
MMRRC Submission 038591-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0385 (G1)
Quality Score225
Status Not validated
Chromosome1
Chromosomal Location63730614-63754655 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 63737811 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 369 (I369F)
Ref Sequence ENSEMBL: ENSMUSP00000027103 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027103]
Predicted Effect probably benign
Transcript: ENSMUST00000027103
AA Change: I369F

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000027103
Gene: ENSMUSG00000025962
AA Change: I369F

DomainStartEndE-ValueType
low complexity region 310 323 N/A INTRINSIC
Pfam:FAST_1 443 512 2.3e-23 PFAM
low complexity region 546 557 N/A INTRINSIC
RAP 619 675 1.66e-16 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128621
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131478
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148758
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.2%
  • 10x: 96.0%
  • 20x: 92.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that is localized in the mitochondrial inner compartment and that may play a role in mitochondrial apoptosis. Nonsense mutations have been reported to result in cytochrome c oxidase deficiency. [provided by RefSeq, Oct 2008]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acaca A G 11: 84,231,748 N331S probably benign Het
Adk A G 14: 21,318,074 N189S probably benign Het
Apc T A 18: 34,315,944 N1930K probably damaging Het
Arhgap28 T C 17: 67,864,606 D391G probably damaging Het
Atn1 G T 6: 124,743,371 probably benign Het
C2cd5 T C 6: 143,041,490 E471G probably damaging Het
Camta1 C A 4: 151,075,140 R1614L probably damaging Het
Cap2 T C 13: 46,560,547 L34P probably damaging Het
Cdc42ep2 T A 19: 5,918,525 M51L probably benign Het
Cntn5 C T 9: 9,972,870 A254T probably damaging Het
Dicer1 A T 12: 104,704,174 L1044H probably damaging Het
Dkk3 A C 7: 112,158,223 M58R probably damaging Het
Dpy19l3 G A 7: 35,752,705 R5W probably damaging Het
Dsg1c C T 18: 20,283,654 P871S probably damaging Het
Dusp1 A T 17: 26,507,696 S131T probably benign Het
Enpp2 C T 15: 54,882,159 G314R probably damaging Het
Fam222b C A 11: 78,154,930 P439Q probably benign Het
Fdps G A 3: 89,094,894 S205F probably damaging Het
Fmo1 A T 1: 162,836,204 V252E possibly damaging Het
Frmd5 A G 2: 121,555,574 Y230H probably damaging Het
Gal C T 19: 3,411,171 V88I probably benign Het
Gm38394 A T 1: 133,656,784 D938E probably damaging Het
Gnptab T C 10: 88,436,525 I1009T probably damaging Het
Idh2 C T 7: 80,098,257 A232T probably damaging Het
Klhdc7a A T 4: 139,966,705 D310E probably benign Het
Klk4 T C 7: 43,884,008 M97T probably benign Het
Krt82 C T 15: 101,545,593 V227M probably damaging Het
Lpp T C 16: 24,761,837 V226A probably damaging Het
Mbd1 AGCTGACTCGGTAC A 18: 74,273,241 probably null Het
Mcm10 T C 2: 5,004,154 K335E possibly damaging Het
Mpv17l A T 16: 13,940,999 I96L probably benign Het
Muc6 G A 7: 141,638,400 S2120F possibly damaging Het
Myb T C 10: 21,154,712 D62G possibly damaging Het
Nasp A T 4: 116,610,695 N364K probably benign Het
Npsr1 A G 9: 24,313,277 N317D probably damaging Het
Nup210 A G 6: 91,028,795 V619A possibly damaging Het
Oser1 C T 2: 163,411,396 probably null Het
Pcdhb4 T C 18: 37,309,215 F526S probably damaging Het
Plekhh3 T C 11: 101,165,141 N444S probably damaging Het
Pnpla5 G T 15: 84,120,719 L144M probably damaging Het
Pou2f2 G A 7: 25,116,076 Q89* probably null Het
Ptprb A G 10: 116,350,178 I1713V probably benign Het
Ptprd A G 4: 76,128,665 Y442H probably damaging Het
Rad21 A T 15: 51,973,863 I152N possibly damaging Het
Ralgapa1 A G 12: 55,677,038 S1568P probably damaging Het
Rhag T A 17: 40,834,727 V357E probably damaging Het
Rnf121 A T 7: 102,029,117 D174E possibly damaging Het
Sdccag3 T C 2: 26,387,659 E41G possibly damaging Het
Sf3b4 T C 3: 96,172,982 Y16H probably damaging Het
Slc1a3 C T 15: 8,639,135 V449I probably damaging Het
Slc20a2 A G 8: 22,568,393 I648M probably benign Het
Slc25a25 T A 2: 32,417,822 I254F probably damaging Het
Slit3 A G 11: 35,700,282 H1307R probably damaging Het
Sorl1 C A 9: 42,031,909 M890I probably damaging Het
Supt16 A C 14: 52,176,718 M468R probably benign Het
Taf4b T C 18: 14,783,760 S56P probably benign Het
Tapt1 T C 5: 44,218,101 probably null Het
Tmco3 T G 8: 13,296,027 C288W probably damaging Het
Tpcn2 A G 7: 145,277,174 Y145H probably damaging Het
Ttn C T 2: 76,881,717 probably benign Het
Usb1 G T 8: 95,345,318 W215C probably damaging Het
Usp2 C G 9: 44,092,750 T305R probably damaging Het
Vmn1r13 G A 6: 57,210,705 S283N probably benign Het
Vps54 A G 11: 21,306,381 K467E possibly damaging Het
Wnk2 G T 13: 49,068,128 S1121Y probably damaging Het
Other mutations in Fastkd2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01067:Fastkd2 APN 1 63737771 splice site probably benign
IGL01890:Fastkd2 APN 1 63732161 missense probably benign 0.06
IGL02698:Fastkd2 APN 1 63747999 missense probably benign 0.01
IGL02992:Fastkd2 APN 1 63737924 splice site probably benign
IGL03208:Fastkd2 APN 1 63739206 missense probably damaging 1.00
R0172:Fastkd2 UTSW 1 63732028 missense possibly damaging 0.78
R0304:Fastkd2 UTSW 1 63752400 missense possibly damaging 0.46
R0486:Fastkd2 UTSW 1 63752340 missense possibly damaging 0.61
R1115:Fastkd2 UTSW 1 63747955 splice site probably benign
R1468:Fastkd2 UTSW 1 63732226 unclassified probably benign
R1579:Fastkd2 UTSW 1 63745887 missense probably null 0.00
R1729:Fastkd2 UTSW 1 63751300 nonsense probably null
R3937:Fastkd2 UTSW 1 63737836 missense possibly damaging 0.48
R4326:Fastkd2 UTSW 1 63752357 missense probably benign 0.07
R4327:Fastkd2 UTSW 1 63752357 missense probably benign 0.07
R4463:Fastkd2 UTSW 1 63735809 intron probably benign
R4473:Fastkd2 UTSW 1 63731674 missense probably damaging 0.97
R4760:Fastkd2 UTSW 1 63745886 missense probably benign 0.00
R5012:Fastkd2 UTSW 1 63749896 intron probably benign
R5176:Fastkd2 UTSW 1 63731439 unclassified probably benign
R5478:Fastkd2 UTSW 1 63739186 missense probably benign 0.13
R5619:Fastkd2 UTSW 1 63739310 missense probably benign 0.25
R6893:Fastkd2 UTSW 1 63731794 missense possibly damaging 0.75
R7038:Fastkd2 UTSW 1 63731873 missense possibly damaging 0.79
R7049:Fastkd2 UTSW 1 63731850 missense probably benign 0.04
R7510:Fastkd2 UTSW 1 63737789 missense possibly damaging 0.83
R7810:Fastkd2 UTSW 1 63731692 missense possibly damaging 0.61
R7972:Fastkd2 UTSW 1 63735460 splice site probably null
Z1177:Fastkd2 UTSW 1 63734836 critical splice donor site probably null
Z1177:Fastkd2 UTSW 1 63734837 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- TGTAGGACCTCCACATCTGACCTATTG -3'
(R):5'- GCACTGGAATACTCTGACAGCCTGAC -3'

Sequencing Primer
(F):5'- GACCTATTGTTTTCAAACCTTGGC -3'
(R):5'- GCCTGACTTCTATAAAGCAGGG -3'
Posted On2013-04-24